GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 17:31:27, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NR_039781                 68 bp    RNA     linear   PRI 01-JUL-2024
DEFINITION  Homo sapiens microRNA 4638 (MIR4638), microRNA.
ACCESSION   NR_039781
VERSION     NR_039781.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 68)
  AUTHORS   Akshaya,R.L., Saranya,I., Salomi,G.M., Shanthi,P., Ilangovan,R.,
            Venkataraman,P. and Selvamurugan,N.
  TITLE     In vivo validation of the functional role of MicroRNA-4638-3p in
            breast cancer bone metastasis
  JOURNAL   J Cancer Res Clin Oncol 150 (2), 63 (2024)
   PUBMED   38300343
  REMARK    GeneRIF: In vivo validation of the functional role of
            MicroRNA-4638-3p in breast cancer bone metastasis.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 68)
  AUTHORS   Enomoto,Y., Takagi,R., Naito,Y., Kiniwa,T., Tanaka,Y.,
            Hamada-Tsutsumi,S., Kawano,M., Matsushita,S., Ochiya,T. and
            Miyajima,A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 68)
  AUTHORS   Wang,Y., Shao,N., Mao,X., Zhu,M., Fan,W., Shen,Z., Xiao,R.,
            Wang,C., Bao,W., Xu,X., Yang,C., Dong,J., Yu,D., Wu,Y., Zhu,C.,
            Wen,L., Lu,X., Lu,Y.J. and Feng,N.
  TITLE     MiR-4638-5p inhibits castration resistance of prostate cancer
            through repressing Kidins220 expression and PI3K/AKT pathway
            activity
  JOURNAL   Oncotarget 7 (30), 47444-47464 (2016)
   PUBMED   27329728
  REMARK    GeneRIF: functional role of miR-4638-5p and its downstream
            genes/pathways have the potential to develop biomarkers for
            castration resistant prostate cancer (CRPC) onset.
REFERENCE   4  (bases 1 to 68)
  AUTHORS   Persson,H., Kvist,A., Rego,N., Staaf,J., Vallon-Christersson,J.,
            Luts,L., Loman,N., Jonsson,G., Naya,H., Hoglund,M., Borg,A. and
            Rovira,C.
  TITLE     Identification of new microRNAs in paired normal and tumor breast
            tissue suggests a dual role for the ERBB2/Her2 gene
  JOURNAL   Cancer Res 71 (1), 78-86 (2011)
   PUBMED   21199797
REFERENCE   5  (bases 1 to 68)
  AUTHORS   Kozomara,A. and Griffiths-Jones,S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   6  (bases 1 to 68)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC008443.10.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611366.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-68                AC008443.10        43105-43172         c
FEATURES             Location/Qualifiers
     source          1..68
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q35.3"
     gene            1..68
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /note="microRNA 4638"
                     /db_xref="GeneID:100616342"
                     /db_xref="HGNC:HGNC:41841"
                     /db_xref="miRBase:MI0017265"
     precursor_RNA   1..68
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /product="microRNA 4638"
                     /db_xref="GeneID:100616342"
                     /db_xref="HGNC:HGNC:41841"
                     /db_xref="miRBase:MI0017265"
     exon            1..68
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           2..22
                     /ncRNA_class="miRNA"
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /product="hsa-miR-4638-5p"
                     /db_xref="miRBase:MIMAT0019695"
                     /db_xref="GeneID:100616342"
                     /db_xref="HGNC:HGNC:41841"
                     /db_xref="miRBase:MI0017265"
     variation       2
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73814538"
     variation       3
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2113131690"
     variation       5
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054122661"
     variation       8
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999139644"
     variation       10
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1582262891"
     variation       11
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2113131671"
     variation       12
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1758328930"
     variation       14
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1582262889"
     variation       18
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146528803"
     variation       21
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278650176"
     variation       24
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1758328579"
     variation       25
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040753016"
     variation       30
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183660888"
     variation       32
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1758328140"
     ncRNA           35..57
                     /ncRNA_class="miRNA"
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /product="hsa-miR-4638-3p"
                     /db_xref="miRBase:MIMAT0019696"
                     /db_xref="GeneID:100616342"
                     /db_xref="HGNC:HGNC:41841"
                     /db_xref="miRBase:MI0017265"
     variation       35..36
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1758328074"
     variation       35
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1211365343"
     variation       36
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943819659"
     variation       37
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946058190"
     variation       38
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1758327914"
     variation       39
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910980755"
     variation       41
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200248325"
     variation       42
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1582262849"
     variation       45
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182757468"
     variation       50
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1758327473"
     variation       51
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049882546"
     variation       54
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2113131563"
     variation       55
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180308032"
     variation       58
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1758327255"
     variation       63
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1468718083"
     variation       67
                     /gene="MIR4638"
                     /gene_synonym="mir-4638"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1582262838"
ORIGIN      
gactcggctgcggtggacaagtccggctccagaacctggacaccgctcagccggccgcggcaggggtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]