ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-26 18:14:18, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_039781 68 bp RNA linear PRI 01-JUL-2024
DEFINITION Homo sapiens microRNA 4638 (MIR4638), microRNA.
ACCESSION NR_039781
VERSION NR_039781.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 68)
AUTHORS Akshaya,R.L., Saranya,I., Salomi,G.M., Shanthi,P., Ilangovan,R.,
Venkataraman,P. and Selvamurugan,N.
TITLE In vivo validation of the functional role of MicroRNA-4638-3p in
breast cancer bone metastasis
JOURNAL J Cancer Res Clin Oncol 150 (2), 63 (2024)
PUBMED 38300343
REMARK GeneRIF: In vivo validation of the functional role of
MicroRNA-4638-3p in breast cancer bone metastasis.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 68)
AUTHORS Enomoto,Y., Takagi,R., Naito,Y., Kiniwa,T., Tanaka,Y.,
Hamada-Tsutsumi,S., Kawano,M., Matsushita,S., Ochiya,T. and
Miyajima,A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 68)
AUTHORS Wang,Y., Shao,N., Mao,X., Zhu,M., Fan,W., Shen,Z., Xiao,R.,
Wang,C., Bao,W., Xu,X., Yang,C., Dong,J., Yu,D., Wu,Y., Zhu,C.,
Wen,L., Lu,X., Lu,Y.J. and Feng,N.
TITLE MiR-4638-5p inhibits castration resistance of prostate cancer
through repressing Kidins220 expression and PI3K/AKT pathway
activity
JOURNAL Oncotarget 7 (30), 47444-47464 (2016)
PUBMED 27329728
REMARK GeneRIF: functional role of miR-4638-5p and its downstream
genes/pathways have the potential to develop biomarkers for
castration resistant prostate cancer (CRPC) onset.
REFERENCE 4 (bases 1 to 68)
AUTHORS Persson,H., Kvist,A., Rego,N., Staaf,J., Vallon-Christersson,J.,
Luts,L., Loman,N., Jonsson,G., Naya,H., Hoglund,M., Borg,A. and
Rovira,C.
TITLE Identification of new microRNAs in paired normal and tumor breast
tissue suggests a dual role for the ERBB2/Her2 gene
JOURNAL Cancer Res 71 (1), 78-86 (2011)
PUBMED 21199797
REFERENCE 5 (bases 1 to 68)
AUTHORS Kozomara,A. and Griffiths-Jones,S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 6 (bases 1 to 68)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC008443.10.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: LM611366.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-68 AC008443.10 43105-43172 c
FEATURES Location/Qualifiers
source 1..68
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q35.3"
gene 1..68
/gene="MIR4638"
/gene_synonym="mir-4638"
/note="microRNA 4638"
/db_xref="GeneID:100616342"
/db_xref="HGNC:HGNC:41841"
/db_xref="miRBase:MI0017265"
precursor_RNA 1..68
/gene="MIR4638"
/gene_synonym="mir-4638"
/product="microRNA 4638"
/db_xref="GeneID:100616342"
/db_xref="HGNC:HGNC:41841"
/db_xref="miRBase:MI0017265"
exon 1..68
/gene="MIR4638"
/gene_synonym="mir-4638"
/inference="alignment:Splign:2.1.0"
ncRNA 2..22
/ncRNA_class="miRNA"
/gene="MIR4638"
/gene_synonym="mir-4638"
/product="hsa-miR-4638-5p"
/db_xref="miRBase:MIMAT0019695"
/db_xref="GeneID:100616342"
/db_xref="HGNC:HGNC:41841"
/db_xref="miRBase:MI0017265"
variation 2
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="c"
/db_xref="dbSNP:73814538"
variation 3
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="g"
/db_xref="dbSNP:2113131690"
variation 5
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054122661"
variation 8
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="t"
/db_xref="dbSNP:999139644"
variation 10
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="g"
/db_xref="dbSNP:1582262891"
variation 11
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:2113131671"
variation 12
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="g"
/db_xref="dbSNP:1758328930"
variation 14
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="g"
/replace="t"
/db_xref="dbSNP:1582262889"
variation 18
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="t"
/db_xref="dbSNP:146528803"
variation 21
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1278650176"
variation 24
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="t"
/db_xref="dbSNP:1758328579"
variation 25
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="g"
/db_xref="dbSNP:1040753016"
variation 30
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="t"
/db_xref="dbSNP:1183660888"
variation 32
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace=""
/replace="g"
/db_xref="dbSNP:1758328140"
ncRNA 35..57
/ncRNA_class="miRNA"
/gene="MIR4638"
/gene_synonym="mir-4638"
/product="hsa-miR-4638-3p"
/db_xref="miRBase:MIMAT0019696"
/db_xref="GeneID:100616342"
/db_xref="HGNC:HGNC:41841"
/db_xref="miRBase:MI0017265"
variation 35..36
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1758328074"
variation 35
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="g"
/db_xref="dbSNP:1211365343"
variation 36
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:943819659"
variation 37
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:946058190"
variation 38
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="g"
/db_xref="dbSNP:1758327914"
variation 39
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="g"
/db_xref="dbSNP:910980755"
variation 41
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="t"
/db_xref="dbSNP:1200248325"
variation 42
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="c"
/db_xref="dbSNP:1582262849"
variation 45
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1182757468"
variation 50
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="g"
/db_xref="dbSNP:1758327473"
variation 51
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="t"
/db_xref="dbSNP:1049882546"
variation 54
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="g"
/db_xref="dbSNP:2113131563"
variation 55
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180308032"
variation 58
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1758327255"
variation 63
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="g"
/replace="t"
/db_xref="dbSNP:1468718083"
variation 67
/gene="MIR4638"
/gene_synonym="mir-4638"
/replace="g"
/replace="t"
/db_xref="dbSNP:1582262838"
ORIGIN
gactcggctgcggtggacaagtccggctccagaacctggacaccgctcagccggccgcggcaggggtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]