ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-29 07:08:23, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_039727 73 bp RNA linear PRI 11-SEP-2024
DEFINITION Homo sapiens microRNA 4505 (MIR4505), microRNA.
ACCESSION NR_039727
VERSION NR_039727.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 73)
AUTHORS Szydelko,J., Czop,M., Petniak,A., Lenart-Lipinska,M., Kocki,J.,
Zapolski,T. and Matyjaszek-Matuszek,B.
TITLE Identification of plasma miR-4505, miR-4743-5p and miR-4750-3p as
novel diagnostic biomarkers for coronary artery disease in patients
with type 2 diabetes mellitus: a case-control study
JOURNAL Cardiovasc Diabetol 23 (1), 278 (2024)
PUBMED 39080630
REMARK GeneRIF: Identification of plasma miR-4505, miR-4743-5p and
miR-4750-3p as novel diagnostic biomarkers for coronary artery
disease in patients with type 2 diabetes mellitus: a case-control
study.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 73)
AUTHORS Sun,W., Chen,J., Li,J., She,X., Ma,H., Wang,S., Liu,J. and Yuan,Y.
TITLE Vitamin D receptor-deficient keratinocytes-derived exosomal
miR-4505 promotes the macrophage polarization towards the M1
phenotype
JOURNAL PeerJ 11, e15798 (2023)
PUBMED 37554338
REMARK GeneRIF: Vitamin D receptor-deficient keratinocytes-derived
exosomal miR-4505 promotes the macrophage polarization towards the
M1 phenotype.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 73)
AUTHORS Hu,W., Xu,B., Zhang,J., Kou,C., Liu,J., Wang,Q. and Zhang,R.
TITLE Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages
reduces endothelial cells permeability and monocyte
transendothelial migration by targeting JAM-C
JOURNAL Exp Cell Res 388 (1), 111823 (2020)
PUBMED 31926946
REFERENCE 4 (bases 1 to 73)
AUTHORS Zhang,X., Chen,Y., Wang,L., Kang,Q., Yu,G., Wan,X., Wang,J. and
Zhu,K.
TITLE MiR-4505 aggravates lipopolysaccharide-induced vascular endothelial
injury by targeting heat shock protein A12B
JOURNAL Mol Med Rep 17 (1), 1389-1395 (2018)
PUBMED 29115487
REMARK GeneRIF: miR4505 downregulates the expression of HSPA12B and
aggravates the LPSinduced vascular endothelial cell injury.
REFERENCE 5 (bases 1 to 73)
AUTHORS Enomoto,Y., Takagi,R., Naito,Y., Kiniwa,T., Tanaka,Y.,
Hamada-Tsutsumi,S., Kawano,M., Matsushita,S., Ochiya,T. and
Miyajima,A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 73)
AUTHORS Kozomara,A. and Griffiths-Jones,S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 7 (bases 1 to 73)
AUTHORS Jima,D.D., Zhang,J., Jacobs,C., Richards,K.L., Dunphy,C.H.,
Choi,W.W., Au,W.Y., Srivastava,G., Czader,M.B., Rizzieri,D.A.,
Lagoo,A.S., Lugar,P.L., Mann,K.P., Flowers,C.R.,
Bernal-Mizrachi,L., Naresh,K.N., Evens,A.M., Gordon,L.I.,
Luftig,M., Friedman,D.R., Weinberg,J.B., Thompson,M.A., Gill,J.I.,
Liu,Q., How,T., Grubor,V., Gao,Y., Patel,A., Wu,H., Zhu,J.,
Blobe,G.C., Lipsky,P.E., Chadburn,A. and Dave,S.S.
CONSRTM Hematologic Malignancies Research Consortium
TITLE Deep sequencing of the small RNA transcriptome of normal and
malignant human B cells identifies hundreds of novel microRNAs
JOURNAL Blood 116 (23), e118-e127 (2010)
PUBMED 20733160
REFERENCE 8 (bases 1 to 73)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC006146.2.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: LM611335.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-73 AC006146.2 5497-5569 c
FEATURES Location/Qualifiers
source 1..73
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="14"
/map="14q24.3"
gene 1..73
/gene="MIR4505"
/gene_synonym="mir-4505"
/note="microRNA 4505"
/db_xref="GeneID:100616158"
/db_xref="HGNC:HGNC:41743"
/db_xref="miRBase:MI0016868"
precursor_RNA 1..73
/gene="MIR4505"
/gene_synonym="mir-4505"
/product="microRNA 4505"
/db_xref="GeneID:100616158"
/db_xref="HGNC:HGNC:41743"
/db_xref="miRBase:MI0016868"
exon 1..73
/gene="MIR4505"
/gene_synonym="mir-4505"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="g"
/db_xref="dbSNP:2053517327"
variation 2
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="g"
/db_xref="dbSNP:1392161470"
ncRNA 3..20
/ncRNA_class="miRNA"
/gene="MIR4505"
/gene_synonym="mir-4505"
/product="hsa-miR-4505"
/db_xref="miRBase:MIMAT0019041"
/db_xref="GeneID:100616158"
/db_xref="HGNC:HGNC:41743"
/db_xref="miRBase:MI0016868"
variation 4
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1335116564"
variation 6
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1250947828"
variation 8
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:943232799"
variation 9
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039375558"
variation 10
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="g"
/db_xref="dbSNP:752570507"
variation 12
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:898855240"
variation 17
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:2140154117"
variation 21
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="c"
/db_xref="dbSNP:763216990"
variation 22
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1595287672"
variation 24
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="g"
/db_xref="dbSNP:2053517748"
variation 25
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:994887965"
variation 26
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="g"
/db_xref="dbSNP:2503168336"
variation 28
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:978828062"
variation 39
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:2053517785"
variation 40
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="g"
/db_xref="dbSNP:2053517838"
variation 41
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:2053517890"
variation 47
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="g"
/replace="t"
/db_xref="dbSNP:1026077058"
variation 48
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1047761468"
variation 49
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="c"
/db_xref="dbSNP:1595287686"
variation 54..56
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="ctc"
/replace="ctctc"
/db_xref="dbSNP:1316366900"
variation 54
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:561639675"
variation 56
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:528851956"
variation 59
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2053518287"
variation 64
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="g"
/db_xref="dbSNP:896090872"
variation 65
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:2053518430"
variation 67
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="a"
/replace="c"
/db_xref="dbSNP:2053518484"
variation 72
/gene="MIR4505"
/gene_synonym="mir-4505"
/replace="c"
/replace="t"
/db_xref="dbSNP:1258876148"
ORIGIN
ggaggctgggctgggacggacacccggcctccactttctgtggcaggtacctcctccatgtcggcccgccttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]