2025-09-19 12:35:49, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NR_039727 73 bp RNA linear PRI 11-SEP-2024 DEFINITION Homo sapiens microRNA 4505 (MIR4505), microRNA. ACCESSION NR_039727 VERSION NR_039727.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 73) AUTHORS Szydelko,J., Czop,M., Petniak,A., Lenart-Lipinska,M., Kocki,J., Zapolski,T. and Matyjaszek-Matuszek,B. TITLE Identification of plasma miR-4505, miR-4743-5p and miR-4750-3p as novel diagnostic biomarkers for coronary artery disease in patients with type 2 diabetes mellitus: a case-control study JOURNAL Cardiovasc Diabetol 23 (1), 278 (2024) PUBMED 39080630 REMARK GeneRIF: Identification of plasma miR-4505, miR-4743-5p and miR-4750-3p as novel diagnostic biomarkers for coronary artery disease in patients with type 2 diabetes mellitus: a case-control study. Publication Status: Online-Only REFERENCE 2 (bases 1 to 73) AUTHORS Sun,W., Chen,J., Li,J., She,X., Ma,H., Wang,S., Liu,J. and Yuan,Y. TITLE Vitamin D receptor-deficient keratinocytes-derived exosomal miR-4505 promotes the macrophage polarization towards the M1 phenotype JOURNAL PeerJ 11, e15798 (2023) PUBMED 37554338 REMARK GeneRIF: Vitamin D receptor-deficient keratinocytes-derived exosomal miR-4505 promotes the macrophage polarization towards the M1 phenotype. Publication Status: Online-Only REFERENCE 3 (bases 1 to 73) AUTHORS Hu,W., Xu,B., Zhang,J., Kou,C., Liu,J., Wang,Q. and Zhang,R. TITLE Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C JOURNAL Exp Cell Res 388 (1), 111823 (2020) PUBMED 31926946 REFERENCE 4 (bases 1 to 73) AUTHORS Zhang,X., Chen,Y., Wang,L., Kang,Q., Yu,G., Wan,X., Wang,J. and Zhu,K. TITLE MiR-4505 aggravates lipopolysaccharide-induced vascular endothelial injury by targeting heat shock protein A12B JOURNAL Mol Med Rep 17 (1), 1389-1395 (2018) PUBMED 29115487 REMARK GeneRIF: miR4505 downregulates the expression of HSPA12B and aggravates the LPSinduced vascular endothelial cell injury. REFERENCE 5 (bases 1 to 73) AUTHORS Enomoto,Y., Takagi,R., Naito,Y., Kiniwa,T., Tanaka,Y., Hamada-Tsutsumi,S., Kawano,M., Matsushita,S., Ochiya,T. and Miyajima,A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 73) AUTHORS Kozomara,A. and Griffiths-Jones,S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 7 (bases 1 to 73) AUTHORS Jima,D.D., Zhang,J., Jacobs,C., Richards,K.L., Dunphy,C.H., Choi,W.W., Au,W.Y., Srivastava,G., Czader,M.B., Rizzieri,D.A., Lagoo,A.S., Lugar,P.L., Mann,K.P., Flowers,C.R., Bernal-Mizrachi,L., Naresh,K.N., Evens,A.M., Gordon,L.I., Luftig,M., Friedman,D.R., Weinberg,J.B., Thompson,M.A., Gill,J.I., Liu,Q., How,T., Grubor,V., Gao,Y., Patel,A., Wu,H., Zhu,J., Blobe,G.C., Lipsky,P.E., Chadburn,A. and Dave,S.S. CONSRTM Hematologic Malignancies Research Consortium TITLE Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs JOURNAL Blood 116 (23), e118-e127 (2010) PUBMED 20733160 REFERENCE 8 (bases 1 to 73) AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and Enright,A.J. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC006146.2. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611335.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-73 AC006146.2 5497-5569 c FEATURES Location/Qualifiers source 1..73 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="14" /map="14q24.3" gene 1..73 /gene="MIR4505" /gene_synonym="mir-4505" /note="microRNA 4505" /db_xref="GeneID:100616158" /db_xref="HGNC:HGNC:41743" /db_xref="miRBase:MI0016868" precursor_RNA 1..73 /gene="MIR4505" /gene_synonym="mir-4505" /product="microRNA 4505" /db_xref="GeneID:100616158" /db_xref="HGNC:HGNC:41743" /db_xref="miRBase:MI0016868" exon 1..73 /gene="MIR4505" /gene_synonym="mir-4505" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="g" /db_xref="dbSNP:2053517327" variation 2 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="g" /db_xref="dbSNP:1392161470" ncRNA 3..20 /ncRNA_class="miRNA" /gene="MIR4505" /gene_synonym="mir-4505" /product="hsa-miR-4505" /db_xref="miRBase:MIMAT0019041" /db_xref="GeneID:100616158" /db_xref="HGNC:HGNC:41743" /db_xref="miRBase:MI0016868" variation 4 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1335116564" variation 6 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1250947828" variation 8 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:943232799" variation 9 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="g" /db_xref="dbSNP:1039375558" variation 10 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="g" /db_xref="dbSNP:752570507" variation 12 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:898855240" variation 17 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:2140154117" variation 21 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="c" /db_xref="dbSNP:763216990" variation 22 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1595287672" variation 24 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="g" /db_xref="dbSNP:2053517748" variation 25 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:994887965" variation 26 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="g" /db_xref="dbSNP:2503168336" variation 28 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:978828062" variation 39 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:2053517785" variation 40 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="g" /db_xref="dbSNP:2053517838" variation 41 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:2053517890" variation 47 /gene="MIR4505" /gene_synonym="mir-4505" /replace="g" /replace="t" /db_xref="dbSNP:1026077058" variation 48 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1047761468" variation 49 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="c" /db_xref="dbSNP:1595287686" variation 54..56 /gene="MIR4505" /gene_synonym="mir-4505" /replace="ctc" /replace="ctctc" /db_xref="dbSNP:1316366900" variation 54 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:561639675" variation 56 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:528851956" variation 59 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:2053518287" variation 64 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="g" /db_xref="dbSNP:896090872" variation 65 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:2053518430" variation 67 /gene="MIR4505" /gene_synonym="mir-4505" /replace="a" /replace="c" /db_xref="dbSNP:2053518484" variation 72 /gene="MIR4505" /gene_synonym="mir-4505" /replace="c" /replace="t" /db_xref="dbSNP:1258876148" ORIGIN
ggaggctgggctgggacggacacccggcctccactttctgtggcaggtacctcctccatgtcggcccgccttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]