GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-29 07:08:23, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_039727                 73 bp    RNA     linear   PRI 11-SEP-2024
DEFINITION  Homo sapiens microRNA 4505 (MIR4505), microRNA.
ACCESSION   NR_039727
VERSION     NR_039727.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 73)
  AUTHORS   Szydelko,J., Czop,M., Petniak,A., Lenart-Lipinska,M., Kocki,J.,
            Zapolski,T. and Matyjaszek-Matuszek,B.
  TITLE     Identification of plasma miR-4505, miR-4743-5p and miR-4750-3p as
            novel diagnostic biomarkers for coronary artery disease in patients
            with type 2 diabetes mellitus: a case-control study
  JOURNAL   Cardiovasc Diabetol 23 (1), 278 (2024)
   PUBMED   39080630
  REMARK    GeneRIF: Identification of plasma miR-4505, miR-4743-5p and
            miR-4750-3p as novel diagnostic biomarkers for coronary artery
            disease in patients with type 2 diabetes mellitus: a case-control
            study.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 73)
  AUTHORS   Sun,W., Chen,J., Li,J., She,X., Ma,H., Wang,S., Liu,J. and Yuan,Y.
  TITLE     Vitamin D receptor-deficient keratinocytes-derived exosomal
            miR-4505 promotes the macrophage polarization towards the M1
            phenotype
  JOURNAL   PeerJ 11, e15798 (2023)
   PUBMED   37554338
  REMARK    GeneRIF: Vitamin D receptor-deficient keratinocytes-derived
            exosomal miR-4505 promotes the macrophage polarization towards the
            M1 phenotype.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 73)
  AUTHORS   Hu,W., Xu,B., Zhang,J., Kou,C., Liu,J., Wang,Q. and Zhang,R.
  TITLE     Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages
            reduces endothelial cells permeability and monocyte
            transendothelial migration by targeting JAM-C
  JOURNAL   Exp Cell Res 388 (1), 111823 (2020)
   PUBMED   31926946
REFERENCE   4  (bases 1 to 73)
  AUTHORS   Zhang,X., Chen,Y., Wang,L., Kang,Q., Yu,G., Wan,X., Wang,J. and
            Zhu,K.
  TITLE     MiR-4505 aggravates lipopolysaccharide-induced vascular endothelial
            injury by targeting heat shock protein A12B
  JOURNAL   Mol Med Rep 17 (1), 1389-1395 (2018)
   PUBMED   29115487
  REMARK    GeneRIF: miR4505 downregulates the expression of HSPA12B and
            aggravates the LPSinduced vascular endothelial cell injury.
REFERENCE   5  (bases 1 to 73)
  AUTHORS   Enomoto,Y., Takagi,R., Naito,Y., Kiniwa,T., Tanaka,Y.,
            Hamada-Tsutsumi,S., Kawano,M., Matsushita,S., Ochiya,T. and
            Miyajima,A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 73)
  AUTHORS   Kozomara,A. and Griffiths-Jones,S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   7  (bases 1 to 73)
  AUTHORS   Jima,D.D., Zhang,J., Jacobs,C., Richards,K.L., Dunphy,C.H.,
            Choi,W.W., Au,W.Y., Srivastava,G., Czader,M.B., Rizzieri,D.A.,
            Lagoo,A.S., Lugar,P.L., Mann,K.P., Flowers,C.R.,
            Bernal-Mizrachi,L., Naresh,K.N., Evens,A.M., Gordon,L.I.,
            Luftig,M., Friedman,D.R., Weinberg,J.B., Thompson,M.A., Gill,J.I.,
            Liu,Q., How,T., Grubor,V., Gao,Y., Patel,A., Wu,H., Zhu,J.,
            Blobe,G.C., Lipsky,P.E., Chadburn,A. and Dave,S.S.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   8  (bases 1 to 73)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC006146.2.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611335.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-73                AC006146.2         5497-5569           c
FEATURES             Location/Qualifiers
     source          1..73
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q24.3"
     gene            1..73
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /note="microRNA 4505"
                     /db_xref="GeneID:100616158"
                     /db_xref="HGNC:HGNC:41743"
                     /db_xref="miRBase:MI0016868"
     precursor_RNA   1..73
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /product="microRNA 4505"
                     /db_xref="GeneID:100616158"
                     /db_xref="HGNC:HGNC:41743"
                     /db_xref="miRBase:MI0016868"
     exon            1..73
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2053517327"
     variation       2
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392161470"
     ncRNA           3..20
                     /ncRNA_class="miRNA"
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /product="hsa-miR-4505"
                     /db_xref="miRBase:MIMAT0019041"
                     /db_xref="GeneID:100616158"
                     /db_xref="HGNC:HGNC:41743"
                     /db_xref="miRBase:MI0016868"
     variation       4
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1335116564"
     variation       6
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250947828"
     variation       8
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:943232799"
     variation       9
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039375558"
     variation       10
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752570507"
     variation       12
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898855240"
     variation       17
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2140154117"
     variation       21
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763216990"
     variation       22
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1595287672"
     variation       24
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2053517748"
     variation       25
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994887965"
     variation       26
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2503168336"
     variation       28
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978828062"
     variation       39
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2053517785"
     variation       40
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2053517838"
     variation       41
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2053517890"
     variation       47
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026077058"
     variation       48
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047761468"
     variation       49
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1595287686"
     variation       54..56
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="ctc"
                     /replace="ctctc"
                     /db_xref="dbSNP:1316366900"
     variation       54
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561639675"
     variation       56
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528851956"
     variation       59
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2053518287"
     variation       64
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896090872"
     variation       65
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2053518430"
     variation       67
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2053518484"
     variation       72
                     /gene="MIR4505"
                     /gene_synonym="mir-4505"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258876148"
ORIGIN      
ggaggctgggctgggacggacacccggcctccactttctgtggcaggtacctcctccatgtcggcccgccttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]