2024-05-05 11:37:08, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_036181 78 bp RNA linear PRI 19-APR-2022 DEFINITION Homo sapiens microRNA 4293 (MIR4293), microRNA. ACCESSION NR_036181 VERSION NR_036181.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 78) AUTHORS Suetsugu H, Kim K, Yamamoto T, Bang SY, Sakamoto Y, Shin JM, Sugano N, Kim JS, Mukai M, Lee YK, Ohmura K, Park DJ, Takahashi D, Ahn GY, Karino K, Kwon YC, Miyamura T, Kim J, Nakamura J, Motomura G, Kuroda T, Niiro H, Miyamoto T, Takeuchi T, Ikari K, Amano K, Tada Y, Yamaji K, Shimizu M, Atsumi T, Seki T, Tanaka Y, Kubo T, Hisada R, Yoshioka T, Yamazaki M, Kabata T, Kajino T, Ohta Y, Okawa T, Naito Y, Kaneuji A, Yasunaga Y, Ohzono K, Tomizuka K, Koido M, Matsuda K, Okada Y, Suzuki A, Kim BJ, Kochi Y, Lee HS, Ikegawa S, Bae SC and Terao C. TITLE Novel susceptibility loci for steroid-associated osteonecrosis of the femoral head in systemic lupus erythematosus JOURNAL Hum Mol Genet 31 (7), 1082-1095 (2022) PUBMED 34850884 REMARK GeneRIF: Novel susceptibility loci for steroid-associated osteonecrosis of the femoral head in systemic lupus erythematosus. REFERENCE 2 (bases 1 to 78) AUTHORS Zhang Q, Yan YF, Lv Q, Li YJ, Wang RR, Sun GB, Pan L, Hu JX, Xie N, Zhang C, Tian BC, Jiao F, Xu S, Wang PY and Xie SY. TITLE miR-4293 upregulates lncRNA WFDC21P by suppressing mRNA-decapping enzyme 2 to promote lung carcinoma proliferation JOURNAL Cell Death Dis 12 (8), 735 (2021) PUBMED 34301920 REMARK GeneRIF: miR-4293 upregulates lncRNA WFDC21P by suppressing mRNA-decapping enzyme 2 to promote lung carcinoma proliferation. Publication Status: Online-Only REFERENCE 3 (bases 1 to 78) AUTHORS Ji D, An M and Fang Q. TITLE Whether miR-4293 rs12220909 variant affects cancer susceptibility: evidence from 11255 subjects JOURNAL Artif Cells Nanomed Biotechnol 48 (1), 933-938 (2020) PUBMED 32496828 REMARK GeneRIF: Whether miR-4293 rs12220909 variant affects cancer susceptibility: evidence from 11255 subjects. REFERENCE 4 (bases 1 to 78) AUTHORS Liu R, Fu H, Yu Y, Xu Q, Fang J, Ge Q and Shao Y. TITLE Association of miR-4293 rs12220909 polymorphism with cancer risk: A meta-analysis of 8394 subjects JOURNAL Medicine (Baltimore) 99 (32), e21364 (2020) PUBMED 32769868 REMARK GeneRIF: Association of miR-4293 rs12220909 polymorphism with cancer risk: A meta-analysis of 8394 subjects. REFERENCE 5 (bases 1 to 78) AUTHORS Fan L, Chen L, Ni X, Guo S, Zhou Y, Wang C, Zheng Y, Shen F, Kolluri VK, Muktiali M, Zhao Z, Wu J, Zhao D, He Z, Feng X, Yuan Z, Zhang J, Jin L, Wang J and Wang M. TITLE Genetic variant of miR-4293 rs12220909 is associated with susceptibility to non-small cell lung cancer in a Chinese Han population JOURNAL PLoS One 12 (4), e0175666 (2017) PUBMED 28410417 REMARK GeneRIF: The GC/CC genotypes of miR-4293 rs12220909 were associated significantly with decreased non-small cell lung cancer susceptibility, which indicates that the mutant allele C of rs12220909 can influence the function of miR-4293. Publication Status: Online-Only REFERENCE 6 (bases 1 to 78) AUTHORS Zhang P, Wang J, Lu T, Wang X, Zheng Y, Guo S, Yang Y, Wang M, Kolluri VK, Qiu L, Shen F, Fan L, Li J, Wang Y, Wei Q, Jin L, Wang J and Wang M. TITLE miR-449b rs10061133 and miR-4293 rs12220909 polymorphisms are associated with decreased esophageal squamous cell carcinoma in a Chinese population JOURNAL Tumour Biol 36 (11), 8789-8795 (2015) PUBMED 26055141 REMARK GeneRIF: This study provides the first evidence that miR-449b rs10061133 and miR-4293 rs12220909 are associated with esophageal squamous cell carcinoma risk in Chinese population. REFERENCE 7 (bases 1 to 78) AUTHORS Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE and Hart RP. TITLE Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors JOURNAL PLoS One 4 (9), e7192 (2009) PUBMED 19784364 REMARK Publication Status: Online-Only REFERENCE 8 (bases 1 to 78) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL139405.11. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-78 AL139405.11 43645-43722 c FEATURES Location/Qualifiers source 1..78 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="10" /map="10p13" gene 1..78 /gene="MIR4293" /note="microRNA 4293" /db_xref="GeneID:100422843" /db_xref="HGNC:HGNC:38270" /db_xref="miRBase:MI0015826" precursor_RNA 1..78 /gene="MIR4293" /product="microRNA 4293" /db_xref="GeneID:100422843" /db_xref="HGNC:HGNC:38270" /db_xref="miRBase:MI0015826" exon 1..78 /gene="MIR4293" /inference="alignment:Splign:2.1.0" variation 2 /gene="MIR4293" /replace="c" /replace="g" /db_xref="dbSNP:1471023807" variation 4 /gene="MIR4293" /replace="c" /replace="g" /db_xref="dbSNP:1844035878" variation 6 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:1468712758" variation 7 /gene="MIR4293" /replace="a" /replace="c" /db_xref="dbSNP:1589341394" variation 8 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:942693802" variation 9 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:1589341390" variation 10 /gene="MIR4293" /replace="a" /replace="t" /db_xref="dbSNP:1844035772" variation 11 /gene="MIR4293" /replace="c" /replace="g" /db_xref="dbSNP:1844035748" variation 15 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:1410759160" variation 16 /gene="MIR4293" /replace="g" /replace="t" /db_xref="dbSNP:1844035700" variation 18 /gene="MIR4293" /replace="g" /replace="t" /db_xref="dbSNP:890074736" variation 22 /gene="MIR4293" /replace="a" /replace="t" /db_xref="dbSNP:1844035654" variation 23 /gene="MIR4293" /replace="a" /replace="g" /db_xref="dbSNP:1844035618" variation 26 /gene="MIR4293" /replace="a" /replace="g" /db_xref="dbSNP:2132160301" variation 27 /gene="MIR4293" /replace="g" /replace="t" /db_xref="dbSNP:2132160299" variation 31 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:1028133324" variation 32 /gene="MIR4293" /replace="a" /replace="g" /db_xref="dbSNP:1177886258" variation 37 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:1423723737" variation 40 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:1844035552" variation 47 /gene="MIR4293" /replace="c" /replace="g" /db_xref="dbSNP:764172340" variation 48 /gene="MIR4293" /replace="a" /replace="g" /db_xref="dbSNP:1844035512" variation 49 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:936869670" variation 50 /gene="MIR4293" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1373538743" variation 51 /gene="MIR4293" /replace="c" /replace="g" /db_xref="dbSNP:1356710265" ncRNA 52..68 /ncRNA_class="miRNA" /gene="MIR4293" /product="hsa-miR-4293" /db_xref="miRBase:MIMAT0016848" /db_xref="GeneID:100422843" /db_xref="HGNC:HGNC:38270" /db_xref="miRBase:MI0015826" variation 53 /gene="MIR4293" /replace="" /replace="a" /db_xref="dbSNP:1844035392" variation 55 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:975745572" variation 56 /gene="MIR4293" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:12220909" variation 65 /gene="MIR4293" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1206375160" variation 68 /gene="MIR4293" /replace="c" /replace="g" /db_xref="dbSNP:1589341374" variation 70 /gene="MIR4293" /replace="a" /replace="c" /db_xref="dbSNP:1844035217" variation 72 /gene="MIR4293" /replace="a" /replace="g" /db_xref="dbSNP:1309964913" variation 73 /gene="MIR4293" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:12780876" variation 74 /gene="MIR4293" /replace="c" /replace="t" /db_xref="dbSNP:2132160281" variation 75 /gene="MIR4293" /replace="a" /replace="t" /db_xref="dbSNP:1589341366" variation 76 /gene="MIR4293" /replace="a" /replace="g" /db_xref="dbSNP:1844035063" ORIGIN
agagacacctgttccttgggaagctggtgacattgctaattcatttcacaccagcctgacaggaacagcctgactgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]