2025-10-16 20:02:07, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_031737 44 bp RNA linear PRI 25-MAR-2023 DEFINITION Homo sapiens microRNA 1973 (MIR1973), microRNA. ACCESSION NR_031737 VERSION NR_031737.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 44) AUTHORS Asri N, Fallah S, Rostami-Nejad M, Fallah Z, Khanlari-Kochaksaraei M, Jafari-Marandi S, Forouzesh F, Shahrokh S, Jahani-Sherafat S and Zali MR. TITLE The role of mir-197-3p in regulating the tight junction permeability of celiac disease patients under gluten free diet JOURNAL Mol Biol Rep 50 (3), 2007-2014 (2023) PUBMED 36536183 REMARK GeneRIF: The role of mir-197-3p in regulating the tight junction permeability of celiac disease patients under gluten free diet. REFERENCE 2 (bases 1 to 44) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 44) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 4 (bases 1 to 44) AUTHORS Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH, Broekhuis MJ, Peters TC, Pieters R and den Boer ML. TITLE Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia JOURNAL Leukemia 23 (2), 313-322 (2009) PUBMED 18923441 REFERENCE 5 (bases 1 to 44) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC024248.7. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM610501.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-44 AC024248.7 62956-62999 FEATURES Location/Qualifiers source 1..44 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="4" /map="4q26" gene 1..44 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /note="microRNA 1973" /db_xref="GeneID:100302290" /db_xref="HGNC:HGNC:37061" /db_xref="miRBase:MI0009983" precursor_RNA 1..44 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /product="microRNA 1973" /db_xref="GeneID:100302290" /db_xref="HGNC:HGNC:37061" /db_xref="miRBase:MI0009983" exon 1..44 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="g" /replace="t" /db_xref="dbSNP:1052623748" variation 2 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:912271420" variation 3 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="t" /db_xref="dbSNP:1723192122" variation 4 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /db_xref="dbSNP:1374890463" variation 9 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /db_xref="dbSNP:753556867" variation 10 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1039481084" variation 11 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:549757587" variation 12 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /db_xref="dbSNP:1723192315" variation 13 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="c" /replace="t" /db_xref="dbSNP:1723192341" variation 14 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="c" /replace="t" /db_xref="dbSNP:1468139610" variation 15 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /db_xref="dbSNP:1394887806" variation 19 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="c" /replace="t" /db_xref="dbSNP:899787803" variation 20 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /db_xref="dbSNP:765167221" variation 23 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="c" /replace="t" /db_xref="dbSNP:1578401403" ncRNA 26..44 /ncRNA_class="miRNA" /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /product="hsa-miR-1973" /db_xref="miRBase:MIMAT0009448" /db_xref="GeneID:100302290" /db_xref="HGNC:HGNC:37061" /db_xref="miRBase:MI0009983" variation 27 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1723192593" variation 28 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:775593889" variation 29 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:183399490" variation 36 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /db_xref="dbSNP:2529697117" variation 37 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="a" /replace="g" /db_xref="dbSNP:2529697119" variation 38 /gene="MIR1973" /gene_synonym="hsa-mir-1973; mir-1973" /replace="c" /replace="t" /db_xref="dbSNP:1578401408" ORIGIN
tatgttcaacggccatggtatcctgaccgtgcaaaggtagcata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]