GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-13 05:48:14, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_031737                 44 bp    RNA     linear   PRI 25-MAR-2023
DEFINITION  Homo sapiens microRNA 1973 (MIR1973), microRNA.
ACCESSION   NR_031737
VERSION     NR_031737.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 44)
  AUTHORS   Asri N, Fallah S, Rostami-Nejad M, Fallah Z, Khanlari-Kochaksaraei
            M, Jafari-Marandi S, Forouzesh F, Shahrokh S, Jahani-Sherafat S and
            Zali MR.
  TITLE     The role of mir-197-3p in regulating the tight junction
            permeability of celiac disease patients under gluten free diet
  JOURNAL   Mol Biol Rep 50 (3), 2007-2014 (2023)
   PUBMED   36536183
  REMARK    GeneRIF: The role of mir-197-3p in regulating the tight junction
            permeability of celiac disease patients under gluten free diet.
REFERENCE   2  (bases 1 to 44)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 44)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   4  (bases 1 to 44)
  AUTHORS   Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH,
            Broekhuis MJ, Peters TC, Pieters R and den Boer ML.
  TITLE     Identification of new microRNA genes and aberrant microRNA profiles
            in childhood acute lymphoblastic leukemia
  JOURNAL   Leukemia 23 (2), 313-322 (2009)
   PUBMED   18923441
REFERENCE   5  (bases 1 to 44)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC024248.7.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM610501.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-44                AC024248.7         62956-62999
FEATURES             Location/Qualifiers
     source          1..44
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q26"
     gene            1..44
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /note="microRNA 1973"
                     /db_xref="GeneID:100302290"
                     /db_xref="HGNC:HGNC:37061"
                     /db_xref="miRBase:MI0009983"
     precursor_RNA   1..44
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /product="microRNA 1973"
                     /db_xref="GeneID:100302290"
                     /db_xref="HGNC:HGNC:37061"
                     /db_xref="miRBase:MI0009983"
     exon            1..44
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052623748"
     variation       2
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912271420"
     variation       3
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1723192122"
     variation       4
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374890463"
     variation       9
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753556867"
     variation       10
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039481084"
     variation       11
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549757587"
     variation       12
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1723192315"
     variation       13
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1723192341"
     variation       14
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468139610"
     variation       15
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394887806"
     variation       19
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899787803"
     variation       20
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765167221"
     variation       23
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1578401403"
     ncRNA           26..44
                     /ncRNA_class="miRNA"
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /product="hsa-miR-1973"
                     /db_xref="miRBase:MIMAT0009448"
                     /db_xref="GeneID:100302290"
                     /db_xref="HGNC:HGNC:37061"
                     /db_xref="miRBase:MI0009983"
     variation       27
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1723192593"
     variation       28
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775593889"
     variation       29
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183399490"
     variation       36
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2529697117"
     variation       37
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2529697119"
     variation       38
                     /gene="MIR1973"
                     /gene_synonym="hsa-mir-1973; mir-1973"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1578401408"
ORIGIN      
tatgttcaacggccatggtatcctgaccgtgcaaaggtagcata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]