ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-23 20:19:44, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031579 91 bp RNA linear PRI 26-SEP-2021
DEFINITION Homo sapiens microRNA 2113 (MIR2113), microRNA.
ACCESSION NR_031579
VERSION NR_031579.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 91)
AUTHORS Zhang L, Chen Y, Bao C, Zhang X and Li H.
TITLE Eukaryotic initiation Factor 4AIII facilitates hepatocellular
carcinoma cell proliferation, migration, and epithelial-mesenchymal
transition process via antagonistically binding to WD repeat domain
66 with miRNA-2113
JOURNAL J Cell Physiol 235 (11), 8199-8209 (2020)
PUBMED 31975383
REMARK GeneRIF: Eukaryotic initiation Factor 4AIII facilitates
hepatocellular carcinoma cell proliferation, migration, and
epithelial-mesenchymal transition process via antagonistically
binding to WD repeat domain 66 with miRNA-2113.
REFERENCE 2 (bases 1 to 91)
AUTHORS Jing J, Xu D, Li Z, Jiang M, Wang J and Zhang J.
TITLE Genetic variants in MIR2113 and MIR129-LEP are associated with the
susceptibility of COPD in the Chinese Han population
JOURNAL Pulm Pharmacol Ther 64, 101945 (2020)
PUBMED 32931917
REMARK GeneRIF: Genetic variants in MIR2113 and MIR129-LEP are associated
with the susceptibility of COPD in the Chinese Han population.
REFERENCE 3 (bases 1 to 91)
AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as
potential targets of miRNAs
JOURNAL Sci Rep 7 (1), 7780 (2017)
PUBMED 28798470
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 91)
AUTHORS Andrews SJ, Das D, Anstey KJ and Easteal S.
TITLE Association of AKAP6 and MIR2113 with cognitive performance in a
population-based sample of older adults
JOURNAL Genes Brain Behav 16 (4), 472-478 (2017)
PUBMED 28067462
REMARK GeneRIF: Two single nucleotide polymorphisms (SNPs),
MIR211-rs10457441 and AKAP6-rs17522122 were genotyped in 1570
non-demented older Australians of European ancestry.
MIR2113-rs10457441*T was associated with accelerated decline in
episodic memory. No other associations with baseline cognitive
performance or with linear or quadratic rate or cognitive changes
were observed for this SNP.
REFERENCE 5 (bases 1 to 91)
AUTHORS Davies G, Armstrong N, Bis JC, Bressler J, Chouraki V, Giddaluru S,
Hofer E, Ibrahim-Verbaas CA, Kirin M, Lahti J, van der Lee SJ, Le
Hellard S, Liu T, Marioni RE, Oldmeadow C, Postmus I, Smith AV,
Smith JA, Thalamuthu A, Thomson R, Vitart V, Wang J, Yu L, Zgaga L,
Zhao W, Boxall R, Harris SE, Hill WD, Liewald DC, Luciano M, Adams
H, Ames D, Amin N, Amouyel P, Assareh AA, Au R, Becker JT, Beiser
A, Berr C, Bertram L, Boerwinkle E, Buckley BM, Campbell H, Corley
J, De Jager PL, Dufouil C, Eriksson JG, Espeseth T, Faul JD, Ford
I, Gottesman RF, Griswold ME, Gudnason V, Harris TB, Heiss G,
Hofman A, Holliday EG, Huffman J, Kardia SL, Kochan N, Knopman DS,
Kwok JB, Lambert JC, Lee T, Li G, Li SC, Loitfelder M, Lopez OL,
Lundervold AJ, Lundqvist A, Mather KA, Mirza SS, Nyberg L, Oostra
BA, Palotie A, Papenberg G, Pattie A, Petrovic K, Polasek O, Psaty
BM, Redmond P, Reppermund S, Rotter JI, Schmidt H, Schuur M,
Schofield PW, Scott RJ, Steen VM, Stott DJ, van Swieten JC, Taylor
KD, Trollor J, Trompet S, Uitterlinden AG, Weinstein G, Widen E,
Windham BG, Jukema JW, Wright AF, Wright MJ, Yang Q, Amieva H,
Attia JR, Bennett DA, Brodaty H, de Craen AJ, Hayward C, Ikram MA,
Lindenberger U, Nilsson LG, Porteous DJ, Raikkonen K, Reinvang I,
Rudan I, Sachdev PS, Schmidt R, Schofield PR, Srikanth V, Starr JM,
Turner ST, Weir DR, Wilson JF, van Duijn C, Launer L, Fitzpatrick
AL, Seshadri S, Mosley TH Jr and Deary IJ.
CONSRTM Generation Scotland
TITLE Genetic contributions to variation in general cognitive function: a
meta-analysis of genome-wide association studies in the CHARGE
consortium (N=53949)
JOURNAL Mol Psychiatry 20 (2), 183-192 (2015)
PUBMED 25644384
REMARK GeneRIF: This study showed that genome-wide significant SNP-based
associations within three genomic regions 6q16.1 (MIR2113), 14q12
(AKAP6/NPAS3 region) and 19q13.32 (TOMM40/APOE region) with
cognition.
REFERENCE 6 (bases 1 to 91)
AUTHORS Muhleisen TW, Leber M, Schulze TG, Strohmaier J, Degenhardt F,
Treutlein J, Mattheisen M, Forstner AJ, Schumacher J, Breuer R,
Meier S, Herms S, Hoffmann P, Lacour A, Witt SH, Reif A,
Muller-Myhsok B, Lucae S, Maier W, Schwarz M, Vedder H,
Kammerer-Ciernioch J, Pfennig A, Bauer M, Hautzinger M, Moebus S,
Priebe L, Czerski PM, Hauser J, Lissowska J, Szeszenia-Dabrowska N,
Brennan P, McKay JD, Wright A, Mitchell PB, Fullerton JM, Schofield
PR, Montgomery GW, Medland SE, Gordon SD, Martin NG, Krasnow V,
Chuchalin A, Babadjanova G, Pantelejeva G, Abramova LI, Tiganov AS,
Polonikov A, Khusnutdinova E, Alda M, Grof P, Rouleau GA, Turecki
G, Laprise C, Rivas F, Mayoral F, Kogevinas M, Grigoroiu-Serbanescu
M, Propping P, Becker T, Rietschel M, Nothen MM and Cichon S.
TITLE Genome-wide association study reveals two new risk loci for bipolar
disorder
JOURNAL Nat Commun 5, 3339 (2014)
PUBMED 24618891
REMARK Publication Status: Online-Only
REFERENCE 7 (bases 1 to 91)
AUTHORS Low SK, Chung S, Takahashi A, Zembutsu H, Mushiroda T, Kubo M and
Nakamura Y.
TITLE Genome-wide association study of chemotherapeutic agent-induced
severe neutropenia/leucopenia for patients in Biobank Japan
JOURNAL Cancer Sci 104 (8), 1074-1082 (2013)
PUBMED 23648065
REFERENCE 8 (bases 1 to 91)
AUTHORS Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L,
Katzenellenbogen M, Ben-Shushan E, Reubinoff BE and Galun E.
TITLE MicroRNA expression patterns and function in endodermal
differentiation of human embryonic stem cells
JOURNAL PLoS One 3 (11), e3726 (2008)
PUBMED 19015728
REFERENCE 9 (bases 1 to 91)
AUTHORS Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L,
Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van
Zonneveld AJ, Mano H, Plasterk R and Cuppen E.
TITLE Many novel mammalian microRNA candidates identified by extensive
cloning and RAKE analysis
JOURNAL Genome Res 16 (10), 1289-1298 (2006)
PUBMED 16954537
REFERENCE 10 (bases 1 to 91)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL590239.7.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-91 AL590239.7 104098-104188
FEATURES Location/Qualifiers
source 1..91
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="6"
/map="6q16.1"
gene 1..91
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/note="microRNA 2113"
/db_xref="GeneID:100302164"
/db_xref="HGNC:HGNC:37058"
/db_xref="miRBase:MI0003939"
precursor_RNA 1..91
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/product="microRNA 2113"
/db_xref="GeneID:100302164"
/db_xref="HGNC:HGNC:37058"
/db_xref="miRBase:MI0003939"
exon 1..91
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="t"
/db_xref="dbSNP:750819020"
variation 5
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="c"
/db_xref="dbSNP:1006033587"
variation 9
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:1772260374"
variation 12
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482249933"
variation 14
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="g"
/replace="t"
/db_xref="dbSNP:2127970574"
variation 15
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="g"
/replace="t"
/db_xref="dbSNP:917485215"
variation 20
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="c"
/db_xref="dbSNP:567387838"
variation 22
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="g"
/db_xref="dbSNP:375206435"
variation 23
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="g"
/replace="t"
/db_xref="dbSNP:1772260503"
variation 24
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="t"
/db_xref="dbSNP:949102376"
variation 26
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="t"
/db_xref="dbSNP:1410202872"
variation 29
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:753328121"
variation 32
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780303302"
variation 38
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1772260666"
variation 39
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="t"
/db_xref="dbSNP:117428639"
variation 40
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:142927919"
variation 44
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="c"
/db_xref="dbSNP:1253750932"
variation 45
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="t"
/db_xref="dbSNP:796275267"
variation 47
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:980377341"
variation 48
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:1772260801"
variation 52
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360211362"
ncRNA 56..76
/ncRNA_class="miRNA"
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/product="hsa-miR-2113"
/db_xref="miRBase:MIMAT0009206"
/db_xref="GeneID:100302164"
/db_xref="HGNC:HGNC:37058"
/db_xref="miRBase:MI0003939"
variation 63
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="g"
/db_xref="dbSNP:1772260863"
variation 66
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1205511802"
variation 67
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:1772260927"
variation 73
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="g"
/replace="t"
/db_xref="dbSNP:899034165"
variation 74
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="g"
/db_xref="dbSNP:1772260979"
variation 77
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:1772261008"
variation 79
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="g"
/replace="t"
/db_xref="dbSNP:1772261027"
variation 80
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="t"
/db_xref="dbSNP:1772261060"
variation 83
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1325246236"
variation 86
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="t"
/db_xref="dbSNP:1772261113"
variation 91
/gene="MIR2113"
/gene_synonym="hsa-mir-2113"
/replace="a"
/replace="g"
/db_xref="dbSNP:926262506"
ORIGIN
ttttcaaagcaatgtgtgacaggtacagggacaaatcccgttaataagtaagaggatttgtgcttggctctgtcacatgccactttgaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]