GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-23 20:19:44, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_031579                 91 bp    RNA     linear   PRI 26-SEP-2021
DEFINITION  Homo sapiens microRNA 2113 (MIR2113), microRNA.
ACCESSION   NR_031579
VERSION     NR_031579.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 91)
  AUTHORS   Zhang L, Chen Y, Bao C, Zhang X and Li H.
  TITLE     Eukaryotic initiation Factor 4AIII facilitates hepatocellular
            carcinoma cell proliferation, migration, and epithelial-mesenchymal
            transition process via antagonistically binding to WD repeat domain
            66 with miRNA-2113
  JOURNAL   J Cell Physiol 235 (11), 8199-8209 (2020)
   PUBMED   31975383
  REMARK    GeneRIF: Eukaryotic initiation Factor 4AIII facilitates
            hepatocellular carcinoma cell proliferation, migration, and
            epithelial-mesenchymal transition process via antagonistically
            binding to WD repeat domain 66 with miRNA-2113.
REFERENCE   2  (bases 1 to 91)
  AUTHORS   Jing J, Xu D, Li Z, Jiang M, Wang J and Zhang J.
  TITLE     Genetic variants in MIR2113 and MIR129-LEP are associated with the
            susceptibility of COPD in the Chinese Han population
  JOURNAL   Pulm Pharmacol Ther 64, 101945 (2020)
   PUBMED   32931917
  REMARK    GeneRIF: Genetic variants in MIR2113 and MIR129-LEP are associated
            with the susceptibility of COPD in the Chinese Han population.
REFERENCE   3  (bases 1 to 91)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 91)
  AUTHORS   Andrews SJ, Das D, Anstey KJ and Easteal S.
  TITLE     Association of AKAP6 and MIR2113 with cognitive performance in a
            population-based sample of older adults
  JOURNAL   Genes Brain Behav 16 (4), 472-478 (2017)
   PUBMED   28067462
  REMARK    GeneRIF: Two single nucleotide polymorphisms (SNPs),
            MIR211-rs10457441 and AKAP6-rs17522122 were genotyped in 1570
            non-demented older Australians of European ancestry.
            MIR2113-rs10457441*T was associated with accelerated decline in
            episodic memory. No other associations with baseline cognitive
            performance or with linear or quadratic rate or cognitive changes
            were observed for this SNP.
REFERENCE   5  (bases 1 to 91)
  AUTHORS   Davies G, Armstrong N, Bis JC, Bressler J, Chouraki V, Giddaluru S,
            Hofer E, Ibrahim-Verbaas CA, Kirin M, Lahti J, van der Lee SJ, Le
            Hellard S, Liu T, Marioni RE, Oldmeadow C, Postmus I, Smith AV,
            Smith JA, Thalamuthu A, Thomson R, Vitart V, Wang J, Yu L, Zgaga L,
            Zhao W, Boxall R, Harris SE, Hill WD, Liewald DC, Luciano M, Adams
            H, Ames D, Amin N, Amouyel P, Assareh AA, Au R, Becker JT, Beiser
            A, Berr C, Bertram L, Boerwinkle E, Buckley BM, Campbell H, Corley
            J, De Jager PL, Dufouil C, Eriksson JG, Espeseth T, Faul JD, Ford
            I, Gottesman RF, Griswold ME, Gudnason V, Harris TB, Heiss G,
            Hofman A, Holliday EG, Huffman J, Kardia SL, Kochan N, Knopman DS,
            Kwok JB, Lambert JC, Lee T, Li G, Li SC, Loitfelder M, Lopez OL,
            Lundervold AJ, Lundqvist A, Mather KA, Mirza SS, Nyberg L, Oostra
            BA, Palotie A, Papenberg G, Pattie A, Petrovic K, Polasek O, Psaty
            BM, Redmond P, Reppermund S, Rotter JI, Schmidt H, Schuur M,
            Schofield PW, Scott RJ, Steen VM, Stott DJ, van Swieten JC, Taylor
            KD, Trollor J, Trompet S, Uitterlinden AG, Weinstein G, Widen E,
            Windham BG, Jukema JW, Wright AF, Wright MJ, Yang Q, Amieva H,
            Attia JR, Bennett DA, Brodaty H, de Craen AJ, Hayward C, Ikram MA,
            Lindenberger U, Nilsson LG, Porteous DJ, Raikkonen K, Reinvang I,
            Rudan I, Sachdev PS, Schmidt R, Schofield PR, Srikanth V, Starr JM,
            Turner ST, Weir DR, Wilson JF, van Duijn C, Launer L, Fitzpatrick
            AL, Seshadri S, Mosley TH Jr and Deary IJ.
  CONSRTM   Generation Scotland
  TITLE     Genetic contributions to variation in general cognitive function: a
            meta-analysis of genome-wide association studies in the CHARGE
            consortium (N=53949)
  JOURNAL   Mol Psychiatry 20 (2), 183-192 (2015)
   PUBMED   25644384
  REMARK    GeneRIF: This study showed that genome-wide significant SNP-based
            associations within three genomic regions 6q16.1 (MIR2113), 14q12
            (AKAP6/NPAS3 region) and 19q13.32 (TOMM40/APOE region) with
            cognition.
REFERENCE   6  (bases 1 to 91)
  AUTHORS   Muhleisen TW, Leber M, Schulze TG, Strohmaier J, Degenhardt F,
            Treutlein J, Mattheisen M, Forstner AJ, Schumacher J, Breuer R,
            Meier S, Herms S, Hoffmann P, Lacour A, Witt SH, Reif A,
            Muller-Myhsok B, Lucae S, Maier W, Schwarz M, Vedder H,
            Kammerer-Ciernioch J, Pfennig A, Bauer M, Hautzinger M, Moebus S,
            Priebe L, Czerski PM, Hauser J, Lissowska J, Szeszenia-Dabrowska N,
            Brennan P, McKay JD, Wright A, Mitchell PB, Fullerton JM, Schofield
            PR, Montgomery GW, Medland SE, Gordon SD, Martin NG, Krasnow V,
            Chuchalin A, Babadjanova G, Pantelejeva G, Abramova LI, Tiganov AS,
            Polonikov A, Khusnutdinova E, Alda M, Grof P, Rouleau GA, Turecki
            G, Laprise C, Rivas F, Mayoral F, Kogevinas M, Grigoroiu-Serbanescu
            M, Propping P, Becker T, Rietschel M, Nothen MM and Cichon S.
  TITLE     Genome-wide association study reveals two new risk loci for bipolar
            disorder
  JOURNAL   Nat Commun 5, 3339 (2014)
   PUBMED   24618891
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 91)
  AUTHORS   Low SK, Chung S, Takahashi A, Zembutsu H, Mushiroda T, Kubo M and
            Nakamura Y.
  TITLE     Genome-wide association study of chemotherapeutic agent-induced
            severe neutropenia/leucopenia for patients in Biobank Japan
  JOURNAL   Cancer Sci 104 (8), 1074-1082 (2013)
   PUBMED   23648065
REFERENCE   8  (bases 1 to 91)
  AUTHORS   Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L,
            Katzenellenbogen M, Ben-Shushan E, Reubinoff BE and Galun E.
  TITLE     MicroRNA expression patterns and function in endodermal
            differentiation of human embryonic stem cells
  JOURNAL   PLoS One 3 (11), e3726 (2008)
   PUBMED   19015728
REFERENCE   9  (bases 1 to 91)
  AUTHORS   Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L,
            Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van
            Zonneveld AJ, Mano H, Plasterk R and Cuppen E.
  TITLE     Many novel mammalian microRNA candidates identified by extensive
            cloning and RAKE analysis
  JOURNAL   Genome Res 16 (10), 1289-1298 (2006)
   PUBMED   16954537
REFERENCE   10 (bases 1 to 91)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL590239.7.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-91                AL590239.7         104098-104188
FEATURES             Location/Qualifiers
     source          1..91
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q16.1"
     gene            1..91
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /note="microRNA 2113"
                     /db_xref="GeneID:100302164"
                     /db_xref="HGNC:HGNC:37058"
                     /db_xref="miRBase:MI0003939"
     precursor_RNA   1..91
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /product="microRNA 2113"
                     /db_xref="GeneID:100302164"
                     /db_xref="HGNC:HGNC:37058"
                     /db_xref="miRBase:MI0003939"
     exon            1..91
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750819020"
     variation       5
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1006033587"
     variation       9
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1772260374"
     variation       12
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2482249933"
     variation       14
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2127970574"
     variation       15
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917485215"
     variation       20
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:567387838"
     variation       22
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375206435"
     variation       23
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1772260503"
     variation       24
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949102376"
     variation       26
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410202872"
     variation       29
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753328121"
     variation       32
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780303302"
     variation       38
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1772260666"
     variation       39
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117428639"
     variation       40
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142927919"
     variation       44
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1253750932"
     variation       45
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:796275267"
     variation       47
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980377341"
     variation       48
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1772260801"
     variation       52
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360211362"
     ncRNA           56..76
                     /ncRNA_class="miRNA"
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /product="hsa-miR-2113"
                     /db_xref="miRBase:MIMAT0009206"
                     /db_xref="GeneID:100302164"
                     /db_xref="HGNC:HGNC:37058"
                     /db_xref="miRBase:MI0003939"
     variation       63
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1772260863"
     variation       66
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205511802"
     variation       67
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1772260927"
     variation       73
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899034165"
     variation       74
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1772260979"
     variation       77
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1772261008"
     variation       79
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1772261027"
     variation       80
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1772261060"
     variation       83
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1325246236"
     variation       86
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1772261113"
     variation       91
                     /gene="MIR2113"
                     /gene_synonym="hsa-mir-2113"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926262506"
ORIGIN      
ttttcaaagcaatgtgtgacaggtacagggacaaatcccgttaataagtaagaggatttgtgcttggctctgtcacatgccactttgaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]