2024-05-05 09:38:40, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_030626 56 bp RNA linear PRI 03-SEP-2020 DEFINITION Homo sapiens microRNA 921 (MIR921), microRNA. ACCESSION NR_030626 VERSION NR_030626.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 56) AUTHORS Choi JY, An BC, Jung IJ, Kim JH and Lee SW. TITLE MiR-921 directly downregulates GPx3 in A549 lung cancer cells JOURNAL Gene 700, 163-167 (2019) PUBMED 30898707 REMARK GeneRIF: Study found that miR-921 expression is downregulated in A549 lung cancer cells. Further data demonstrate that miR-921 directly inhibits GPx3 expression in A549 lung cancer cells. REFERENCE 2 (bases 1 to 56) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 56) AUTHORS Kalabus JL, Cheng Q and Blanco JG. TITLE MicroRNAs differentially regulate carbonyl reductase 1 (CBR1) gene expression dependent on the allele status of the common polymorphic variant rs9024 JOURNAL PLoS ONE 7 (11), e48622 (2012) PUBMED 23133646 REMARK GeneRIF: regulation of human CBR1 expression by hsa-miR-574-5p and hsa-miR-921 depends upon rs9024 genotype status REFERENCE 4 (bases 1 to 56) AUTHORS Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E and Leffers H. TITLE Analysis of gene expression in normal and neoplastic human testis: new roles of RNA JOURNAL Int. J. Androl. 30 (4), 316-26 (2007) PUBMED 17573847 REFERENCE 5 (bases 1 to 56) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL596087.11. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-56 AL596087.11 34738-34793 c FEATURES Location/Qualifiers source 1..56 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="1" /map="1q24.1" gene 1..56 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /note="microRNA 921" /db_xref="GeneID:100126349" /db_xref="HGNC:HGNC:33671" /db_xref="miRBase:MI0005713" precursor_RNA 1..56 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /product="microRNA 921" /db_xref="GeneID:100126349" /db_xref="HGNC:HGNC:33671" /db_xref="miRBase:MI0005713" exon 1..56 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="g" /db_xref="dbSNP:927382951" ncRNA 2..26 /ncRNA_class="miRNA" /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /product="hsa-miR-921" /db_xref="miRBase:MIMAT0004971" /db_xref="GeneID:100126349" /db_xref="HGNC:HGNC:33671" /db_xref="miRBase:MI0005713" variation 4 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="g" /db_xref="dbSNP:1464259216" variation 6 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="c" /replace="t" /db_xref="dbSNP:1655831278" variation 9 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="g" /db_xref="dbSNP:768428855" variation 21 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="g" /db_xref="dbSNP:746970999" variation 24 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="c" /replace="t" /db_xref="dbSNP:2101801252" variation 29 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="g" /db_xref="dbSNP:2101801248" variation 30 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="c" /replace="t" /db_xref="dbSNP:1438535041" variation 32 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:956176621" variation 36 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:775467908" variation 39 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:745911319" variation 40 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="c" /replace="t" /db_xref="dbSNP:779291725" variation 41 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="g" /db_xref="dbSNP:1199038899" variation 43 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="g" /replace="t" /db_xref="dbSNP:1353122810" variation 45 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="c" /replace="t" /db_xref="dbSNP:1655829715" variation 46 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:757486025" variation 50 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="" /replace="t" /db_xref="dbSNP:373754478" variation 50 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="c" /replace="t" /db_xref="dbSNP:1239605888" variation 51 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="c" /db_xref="dbSNP:748921038" variation 52 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="a" /replace="g" /db_xref="dbSNP:749515564" variation 54 /gene="MIR921" /gene_synonym="hsa-mir-921; MIRN921" /replace="g" /replace="t" /db_xref="dbSNP:1307059775" ORIGIN
actagtgagggacagaaccaggattcagactcaggtccatgggcctggatcactgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]