ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-20 08:49:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_030621 80 bp RNA linear PRI 21-AUG-2023
DEFINITION Homo sapiens microRNA 760 (MIR760), microRNA.
ACCESSION NR_030621
VERSION NR_030621.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 80)
AUTHORS El-Aal AEA, Elshafei A, Ismail MY and El-Shafey MM.
TITLE Identification of miR-106b-5p, miR-601, and miR-760 Expression and
Their Clinical Values in Non-Small Cell Lung Cancer (NSCLC)
Patients' Serum
JOURNAL Pathol Res Pract 248, 154663 (2023)
PUBMED 37429174
REMARK GeneRIF: Identification of miR-106b-5p, miR-601, and miR-760
Expression and Their Clinical Values in Non-Small Cell Lung Cancer
(NSCLC) Patients' Serum.
REFERENCE 2 (bases 1 to 80)
AUTHORS Yang H, Li Z, Wang Z, Zhang X, Dai X, Zhou G and Ding Q.
TITLE Histocompatibility Minor 13 (HM13), targeted by miR-760, exerts
oncogenic role in breast cancer by suppressing autophagy and
activating PI3K-AKT-mTOR pathway
JOURNAL Cell Death Dis 13 (8), 728 (2022)
PUBMED 36153332
REMARK GeneRIF: Histocompatibility Minor 13 (HM13), targeted by miR-760,
exerts oncogenic role in breast cancer by suppressing autophagy and
activating PI3K-AKT-mTOR pathway.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 80)
AUTHORS Ge H, Wang L, Chen W and Wang L.
TITLE Mechanism of miR-760 Reversing Lung Cancer Immune Escape by
Downregulating IDO1 and Eliminating Regulatory T Cells Based on
Mathematical Biology
JOURNAL Comput Math Methods Med 2022, 2960773 (2022)
PUBMED 35872931
REMARK GeneRIF: Mechanism of miR-760 Reversing Lung Cancer Immune Escape
by Downregulating IDO1 and Eliminating Regulatory T Cells Based on
Mathematical Biology.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 80)
AUTHORS Lee Y and Bae YS.
TITLE Long Non-Coding RNA KCNQ1OT1 Regulates Protein Kinase CK2 Via
miR-760 in Senescence and Calorie Restriction
JOURNAL Int J Mol Sci 23 (3), 1888 (2022)
PUBMED 35163809
REMARK GeneRIF: Long Non-Coding RNA KCNQ1OT1 Regulates Protein Kinase CK2
Via miR-760 in Senescence and Calorie Restriction.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 80)
AUTHORS Abdelaleem OO, Fouad NA, Shaker OG, Ahmed TI, Abdelghaffar NK, Eid
HM, Mohamed AA, Elebiary AM, Mohamed MM and Mahmoud RH.
TITLE Serum miR-224, miR-760, miR-483-5p, miR-378 and miR-375 as
potential novel biomarkers in rheumatoid arthritis
JOURNAL Int J Clin Pract 75 (11), e14651 (2021)
PUBMED 34310809
REMARK GeneRIF: Serum miR-224, miR-760, miR-483-5p, miR-378 and miR-375 as
potential novel biomarkers in rheumatoid arthritis.
REFERENCE 6 (bases 1 to 80)
AUTHORS Wang Q, Huang Z, Ni S, Xiao X, Xu Q, Wang L, Huang D, Tan C, Sheng
W and Du X.
TITLE Plasma miR-601 and miR-760 are novel biomarkers for the early
detection of colorectal cancer
JOURNAL PLoS One 7 (9), e44398 (2012)
PUBMED 22970209
REMARK GeneRIF: Plasma miR-601 and miR-760 can potentially serve as
promising non-invasive biomarkers for the early detection of
colorectal cancer.
REFERENCE 7 (bases 1 to 80)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 8 (bases 1 to 80)
AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
Zavolan M and Tuschl T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 9 (bases 1 to 80)
AUTHORS Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L,
Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van
Zonneveld AJ, Mano H, Plasterk R and Cuppen E.
TITLE Many novel mammalian microRNA candidates identified by extensive
cloning and RAKE analysis
JOURNAL Genome Res 16 (10), 1289-1298 (2006)
PUBMED 16954537
REFERENCE 10 (bases 1 to 80)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL049796.28.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM609972.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-80 AL049796.28 42855-42934 c
FEATURES Location/Qualifiers
source 1..80
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p22.1"
gene 1..80
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/note="microRNA 760"
/db_xref="GeneID:100126348"
/db_xref="HGNC:HGNC:33666"
/db_xref="miRBase:MI0005567"
precursor_RNA 1..80
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/product="microRNA 760"
/db_xref="GeneID:100126348"
/db_xref="HGNC:HGNC:33666"
/db_xref="miRBase:MI0005567"
exon 1..80
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1287002793"
variation 2
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1655219398"
variation 3
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="g"
/db_xref="dbSNP:763268935"
variation 4
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:764499853"
variation 5
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:1280162461"
variation 8
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1035538232"
variation 10..15
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="ccccc"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:535725538"
variation 10
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1209720917"
variation 11
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:774657435"
variation 12
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:762311695"
variation 13
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:1655220669"
variation 14
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="g"
/db_xref="dbSNP:749993494"
variation 15..17
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="ctc"
/db_xref="dbSNP:1557709403"
variation 15
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="g"
/db_xref="dbSNP:1655221528"
variation 17
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:760223122"
variation 18
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1411117897"
variation 21
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:1655221979"
variation 22..24
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="cac"
/db_xref="dbSNP:1323516207"
variation 24
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/db_xref="dbSNP:1478338919"
variation 27
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:1173194143"
variation 29
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:1655222475"
variation 30
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:765983578"
variation 31
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:753503714"
variation 32
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:754536262"
variation 33
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:778885065"
variation 37
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:1341667092"
variation 38
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/db_xref="dbSNP:1280541129"
variation 43
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="g"
/db_xref="dbSNP:1398504717"
variation 45
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:752476649"
ncRNA 49..68
/ncRNA_class="miRNA"
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/product="hsa-miR-760"
/db_xref="miRBase:MIMAT0004957"
/db_xref="GeneID:100126348"
/db_xref="HGNC:HGNC:33666"
/db_xref="miRBase:MI0005567"
variation 49
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/db_xref="dbSNP:758427333"
variation 52
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:777843882"
variation 54
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:746002336"
variation 55
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="t"
/db_xref="dbSNP:569643928"
variation 57
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="g"
/replace="t"
/db_xref="dbSNP:1276046124"
variation 58
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:1655223934"
variation 60
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:1655224021"
variation 62
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1342263462"
variation 63
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="g"
/replace="t"
/db_xref="dbSNP:1655224191"
variation 65
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:1233011400"
variation 66
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:1274893839"
variation 68
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="t"
/db_xref="dbSNP:769888275"
variation 69
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:1655224523"
variation 70
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="c"
/db_xref="dbSNP:780190694"
variation 76
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="g"
/db_xref="dbSNP:749549248"
variation 77
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:1452063390"
variation 78
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="a"
/replace="t"
/db_xref="dbSNP:1200932385"
variation 80
/gene="MIR760"
/gene_synonym="hsa-mir-760; mir-760; MIRN760"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425663551"
ORIGIN
ggcgcgtcgcccccctcagtccaccagagcccggatacctcagaaattcggctctgggtctgtggggagcgaaatgcaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]