ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-19 18:13:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_030304 96 bp RNA linear PRI 15-OCT-2023
DEFINITION Homo sapiens microRNA 578 (MIR578), microRNA.
ACCESSION NR_030304
VERSION NR_030304.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 96)
AUTHORS Shi Y, Tian Y, Wu Y and Zhao Y.
TITLE CircTNPO1 promotes the tumorigenesis of osteosarcoma by
sequestering miR-578 to upregulate WNT5A expression
JOURNAL Cell Signal 111, 110858 (2023)
PUBMED 37633479
REMARK GeneRIF: CircTNPO1 promotes the tumorigenesis of osteosarcoma by
sequestering miR-578 to upregulate WNT5A expression.
REFERENCE 2 (bases 1 to 96)
AUTHORS Sun L, Chen S, Wang T and Bi S.
TITLE Hsa_circ_0008673 Promotes Breast Cancer Progression by
MiR-578/GINS4 Axis
JOURNAL Clin Breast Cancer 23 (3), 281-290 (2023)
PUBMED 36628810
REMARK GeneRIF: Hsa_circ_0008673 Promotes Breast Cancer Progression by
MiR-578/GINS4 Axis.
REFERENCE 3 (bases 1 to 96)
AUTHORS Hu R, Chen S and Yan J.
TITLE Blocking circ-CNST suppresses malignant behaviors of osteosarcoma
cells and inhibits glycolysis through circ-CNST-miR-578-LDHA/PDK1
ceRNA networks
JOURNAL J Orthop Surg Res 16 (1), 300 (2021)
PUBMED 33962616
REMARK GeneRIF: Blocking circ-CNST suppresses malignant behaviors of
osteosarcoma cells and inhibits glycolysis through
circ-CNST-miR-578-LDHA/PDK1 ceRNA networks.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 96)
AUTHORS Ji X, Shan L, Shen P and He M.
TITLE Circular RNA circ_001621 promotes osteosarcoma cells proliferation
and migration by sponging miR-578 and regulating VEGF expression
JOURNAL Cell Death Dis 11 (1), 18 (2020)
PUBMED 31907361
REMARK GeneRIF: Circular RNA circ_001621 promotes osteosarcoma cells
proliferation and migration by sponging miR-578 and regulating VEGF
expression.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 96)
AUTHORS Danza K, De Summa S, Pinto R, Pilato B, Palumbo O, Merla G, Simone
G and Tommasi S.
TITLE MiR-578 and miR-573 as potential players in BRCA-related breast
cancer angiogenesis
JOURNAL Oncotarget 6 (1), 471-483 (2015)
PUBMED 25333258
REMARK GeneRIF: Our data highlight the role of miR-578 and miR-573 in
controlling BRCA 1/2-related angiogenesis in a series of familial
breast cancers
REFERENCE 6 (bases 1 to 96)
AUTHORS Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T,
Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK,
Roberts BS, Juhl H, Kinzler KW, Vogelstein B and Velculescu VE.
TITLE The colorectal microRNAome
JOURNAL Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006)
PUBMED 16505370
REFERENCE 7 (bases 1 to 96)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC012504.7.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-96 AC012504.7 63297-63392
FEATURES Location/Qualifiers
source 1..96
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="4"
/map="4q32.3"
gene 1..96
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/note="microRNA 578"
/db_xref="GeneID:693163"
/db_xref="HGNC:HGNC:32834"
/db_xref="miRBase:MI0003585"
precursor_RNA 1..96
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/product="microRNA 578"
/db_xref="GeneID:693163"
/db_xref="HGNC:HGNC:32834"
/db_xref="miRBase:MI0003585"
exon 1..96
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/inference="alignment:Splign:2.1.0"
variation 2
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:766247747"
variation 3
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:751472300"
variation 5..7
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1730589740"
variation 6
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="t"
/db_xref="dbSNP:1209292277"
variation 10
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001214477"
variation 11
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:369972480"
variation 12
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1055758873"
variation 13
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:896036125"
variation 14
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:754769456"
variation 16
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054112523"
variation 19
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1730590308"
variation 20
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1477343564"
variation 27
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:780942957"
variation 29
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:201912126"
variation 30
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:371636002"
variation 31
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="g"
/db_xref="dbSNP:200005096"
variation 32..38
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="acaa"
/replace="acaacaa"
/db_xref="dbSNP:1270243083"
variation 36
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="g"
/db_xref="dbSNP:369159029"
variation 37
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1730590977"
variation 39
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="g"
/db_xref="dbSNP:770438155"
variation 43
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388156691"
variation 46
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:1311619927"
variation 48
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1238719161"
variation 51
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302589747"
variation 54
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:200991991"
variation 57
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:746367233"
ncRNA 61..81
/ncRNA_class="miRNA"
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/product="hsa-miR-578"
/db_xref="miRBase:MIMAT0003243"
/db_xref="GeneID:693163"
/db_xref="HGNC:HGNC:32834"
/db_xref="miRBase:MI0003585"
variation 64
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="c"
/db_xref="dbSNP:1217147234"
variation 65
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:772626574"
variation 72
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:1730591487"
variation 73
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1308585700"
variation 74
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1244239446"
variation 76
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263759681"
variation 78
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489469966"
variation 80
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:775988332"
variation 82
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263395859"
variation 88
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:747306944"
variation 92
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:867723813"
variation 93
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:769009692"
variation 94
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="c"
/replace="t"
/db_xref="dbSNP:776942191"
variation 95
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="g"
/db_xref="dbSNP:1429048259"
variation 96
/gene="MIR578"
/gene_synonym="hsa-mir-578; MIRN578"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163907435"
ORIGIN
agataaatctatagacaaaatacaatcccggacaacaagaagctcctatagctcctgtagcttcttgtgctctaggattgtattttgtttatatat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]