ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-20 06:07:24, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_029897 67 bp RNA linear PRI 22-OCT-2023
DEFINITION Homo sapiens microRNA 338 (MIR338), microRNA.
ACCESSION NR_029897
VERSION NR_029897.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 67)
AUTHORS Dou XL, Xia FD and Li XY.
TITLE Circ_0003747 promotes thyroid cancer progression by sponging
miR-338-3p to upregulate PLCD3 expression
JOURNAL Epigenetics 18 (1), 2210339 (2023)
PUBMED 37166441
REMARK GeneRIF: Circ_0003747 promotes thyroid cancer progression by
sponging miR-338-3p to upregulate PLCD3 expression.
REFERENCE 2 (bases 1 to 67)
AUTHORS Shi Y, Pan J, Hang C, Tan L, Hu L, Yan Z and Zhu J.
TITLE The estrogen/miR-338-3p/ADAM17 axis enhances the viability of
breast cancer cells via suppressing NK cell's function
JOURNAL Environ Toxicol 38 (7), 1618-1627 (2023)
PUBMED 37052432
REMARK GeneRIF: The estrogen/miR-338-3p/ADAM17 axis enhances the viability
of breast cancer cells via suppressing NK cell's function.
REFERENCE 3 (bases 1 to 67)
AUTHORS Li Y, Zhao S and Chen B.
TITLE Mechanism of lncRNA FOXD3-AS1/miR-338-3p in the malignant
progression of nasopharyngeal carcinoma through ceRNA
JOURNAL Cell Mol Biol (Noisy-le-grand) 69 (6), 82-87 (2023)
PUBMED 37605586
REMARK GeneRIF: Mechanism of lncRNA FOXD3-AS1/miR-338-3p in the malignant
progression of nasopharyngeal carcinoma through ceRNA.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 67)
AUTHORS Xu C, Sun W, Liu J, Pu H and Li Y.
TITLE Circ_RBM23 knockdown suppresses chemoresistance, proliferation,
migration and invasion of sorafenib-resistant HCC cells through
miR-338-3p/RAB1B axis
JOURNAL Pathol Res Pract 245, 154435 (2023)
PUBMED 37075641
REMARK GeneRIF: Circ_RBM23 knockdown suppresses chemoresistance,
proliferation, migration and invasion of sorafenib-resistant HCC
cells through miR-338-3p/RAB1B axis.
REFERENCE 5 (bases 1 to 67)
AUTHORS Geng Y, Chen P, Zhang L, Li X, Song C, Wei X and Gong H.
TITLE LncRNA MALAT1 regulates growth of carcinoma of the lung through
modulating miR-338-3p/PYCR2 axis
JOURNAL Cell Mol Biol (Noisy-le-grand) 69 (4), 133-140 (2023)
PUBMED 37329534
REMARK GeneRIF: LncRNA MALAT1 regulates growth of carcinoma of the lung
through modulating miR-338-3p/PYCR2 axis.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 67)
AUTHORS Lui WO, Pourmand N, Patterson BK and Fire A.
TITLE Patterns of known and novel small RNAs in human cervical cancer
JOURNAL Cancer Res 67 (13), 6031-6043 (2007)
PUBMED 17616659
REFERENCE 7 (bases 1 to 67)
AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
Zavolan M and Tuschl T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 8 (bases 1 to 67)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 9 (bases 1 to 67)
AUTHORS Weber MJ.
TITLE New human and mouse microRNA genes found by homology search
JOURNAL FEBS J 272 (1), 59-73 (2005)
PUBMED 15634332
REFERENCE 10 (bases 1 to 67)
AUTHORS Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM and
Ruvkun G.
TITLE Identification of many microRNAs that copurify with polyribosomes
in mammalian neurons
JOURNAL Proc Natl Acad Sci U S A 101 (1), 360-365 (2004)
PUBMED 14691248
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC115099.6.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM608732.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-67 AC115099.6 113257-113323 c
FEATURES Location/Qualifiers
source 1..67
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q25.3"
gene 1..67
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/note="microRNA 338"
/db_xref="GeneID:442906"
/db_xref="HGNC:HGNC:31775"
/db_xref="MIM:614059"
/db_xref="miRBase:MI0000814"
precursor_RNA 1..67
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/product="microRNA 338"
/db_xref="GeneID:442906"
/db_xref="HGNC:HGNC:31775"
/db_xref="MIM:614059"
/db_xref="miRBase:MI0000814"
exon 1..67
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/inference="alignment:Splign:2.1.0"
variation 2
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="g"
/db_xref="dbSNP:1227489266"
ncRNA 6..27
/ncRNA_class="miRNA"
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/product="hsa-miR-338-5p"
/db_xref="miRBase:MIMAT0004701"
/db_xref="GeneID:442906"
/db_xref="HGNC:HGNC:31775"
/db_xref="MIM:614059"
/db_xref="miRBase:MI0000814"
variation 12
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:766400159"
variation 14
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:531755412"
variation 16
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:1164577004"
variation 25
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1459815126"
variation 27..30
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="gatg"
/replace="gatggatg"
/db_xref="dbSNP:779868418"
variation 31
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="t"
/db_xref="dbSNP:2060811772"
variation 33
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:1164428746"
variation 34
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:2060811647"
variation 36
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:2060811590"
variation 37
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:2060811531"
variation 38
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:571145993"
variation 39
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:770020068"
variation 40
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:762229473"
variation 41
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:1482013628"
ncRNA 42..63
/ncRNA_class="miRNA"
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/product="hsa-miR-338-3p"
/db_xref="miRBase:MIMAT0000763"
/db_xref="GeneID:442906"
/db_xref="HGNC:HGNC:31775"
/db_xref="MIM:614059"
/db_xref="miRBase:MI0000814"
variation 43
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="g"
/db_xref="dbSNP:1251048260"
variation 46
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:2060811098"
variation 48
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210197719"
variation 50
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598916986"
variation 51
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="t"
/db_xref="dbSNP:1489376916"
variation 55
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:931624243"
variation 58
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:1263458335"
variation 61
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="c"
/replace="t"
/db_xref="dbSNP:2060810704"
variation 66
/gene="MIR338"
/gene_synonym="hsa-mir-338; mir-338; MIRN338"
/replace="a"
/replace="g"
/db_xref="dbSNP:2060810625"
ORIGIN
tctccaacaatatcctggtgctgagtgatgactcaggcgactccagcatcagtgattttgttgaaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]