ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-26 13:49:00, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_029835 69 bp RNA linear PRI 02-MAR-2023
DEFINITION Homo sapiens microRNA 302a (MIR302A), microRNA.
ACCESSION NR_029835
VERSION NR_029835.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 69)
AUTHORS Lin L, Lin D, Jin L, Wang J, Lin Z, Zhang S and Lin G.
TITLE LncRNA HOXA-AS2 Promotes Temozolomide Resistance in Glioblastoma by
Regulated miR-302a-3p/IGF1 Axis
JOURNAL Genet Res (Camb) 2022, 3941952 (2022)
PUBMED 36479381
REMARK GeneRIF: LncRNA HOXA-AS2 Promotes Temozolomide Resistance in
Glioblastoma by Regulated miR-302a-3p/IGF1 Axis.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 69)
AUTHORS Wu M, Zhao Y, Li L, Wang G and Xing L.
TITLE Exosomal microRNA-302a promotes trophoblast migration and
proliferation, and represses angiogenesis by regulating the
expression levels of VEGFA in preeclampsia
JOURNAL Mol Med Rep 24 (6) (2021)
PUBMED 34676880
REMARK GeneRIF: Exosomal microRNA302a promotes trophoblast migration and
proliferation, and represses angiogenesis by regulating the
expression levels of VEGFA in preeclampsia.
REFERENCE 3 (bases 1 to 69)
AUTHORS Bai T, Cui Y, Yang X, Cui X, Yan C, Tang Y, Cao X and Dong C.
TITLE miR-302a-3p targets FMR1 to regulate pyroptosis of renal tubular
epithelial cells induced by hypoxia-reoxygenation injury
JOURNAL Exp Physiol 106 (12), 2531-2541 (2021)
PUBMED 34605097
REMARK GeneRIF: miR-302a-3p targets FMR1 to regulate pyroptosis of renal
tubular epithelial cells induced by hypoxia-reoxygenation injury.
REFERENCE 4 (bases 1 to 69)
AUTHORS Zhong C, Tao B, Yang F, Xia K, Yang X, Chen L, Peng T, Xia X, Li X
and Peng L.
TITLE Histone demethylase JMJD1C promotes the polarization of M1
macrophages to prevent glioma by upregulating miR-302a
JOURNAL Clin Transl Med 11 (9), e424 (2021)
PUBMED 34586733
REMARK GeneRIF: Histone demethylase JMJD1C promotes the polarization of M1
macrophages to prevent glioma by upregulating miR-302a.
REFERENCE 5 (bases 1 to 69)
AUTHORS Wei D, Ke YQ, Duan P, Zhou L, Wang CY and Cao P.
TITLE MicroRNA-302a-3p induces ferroptosis of non-small cell lung cancer
cells via targeting ferroportin
JOURNAL Free Radic Res 55 (7), 821-830 (2021)
PUBMED 34181495
REMARK GeneRIF: MicroRNA-302a-3p induces ferroptosis of non-small cell
lung cancer cells via targeting ferroportin.
REFERENCE 6 (bases 1 to 69)
AUTHORS Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
Zavolan M and Tuschl T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 7 (bases 1 to 69)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 8 (bases 1 to 69)
AUTHORS Weber MJ.
TITLE New human and mouse microRNA genes found by homology search
JOURNAL FEBS J 272 (1), 59-73 (2005)
PUBMED 15634332
REFERENCE 9 (bases 1 to 69)
AUTHORS Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM,
Yoon HS, Moon SY, Kim VN and Kim KS.
TITLE Human embryonic stem cells express a unique set of microRNAs
JOURNAL Dev Biol 270 (2), 488-498 (2004)
PUBMED 15183728
REFERENCE 10 (bases 1 to 69)
AUTHORS Houbaviy HB, Murray MF and Sharp PA.
TITLE Embryonic stem cell-specific MicroRNAs
JOURNAL Dev Cell 5 (2), 351-358 (2003)
PUBMED 12919684
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC106864.5.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM608665.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-69 AC106864.5 11273-11341 c
FEATURES Location/Qualifiers
source 1..69
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="4"
/map="4q25"
gene 1..69
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/note="microRNA 302a"
/db_xref="GeneID:407028"
/db_xref="HGNC:HGNC:31623"
/db_xref="MIM:614596"
/db_xref="miRBase:MI0000738"
precursor_RNA 1..69
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/product="microRNA 302a"
/db_xref="GeneID:407028"
/db_xref="HGNC:HGNC:31623"
/db_xref="MIM:614596"
/db_xref="miRBase:MI0000738"
exon 1..69
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/inference="alignment:Splign:2.1.0"
variation 1..7
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="ccac"
/replace="ccaccac"
/db_xref="dbSNP:763883824"
variation 1
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:769885618"
variation 2
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="g"
/db_xref="dbSNP:565608094"
variation 3
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1480954687"
variation 4
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781077657"
variation 5
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:368344055"
ncRNA 6..28
/ncRNA_class="miRNA"
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/product="hsa-miR-302a-5p"
/db_xref="miRBase:MIMAT0000683"
/db_xref="GeneID:407028"
/db_xref="HGNC:HGNC:31623"
/db_xref="MIM:614596"
/db_xref="miRBase:MI0000738"
variation 6..8
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace=""
/replace="act"
/db_xref="dbSNP:2048455195"
variation 6
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1462342391"
variation 10..35
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="aaac"
/replace="aaacgtggatgtacttgctttgaaac"
/db_xref="dbSNP:757634396"
variation 10..12
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="aa"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1560938845"
variation 11
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="t"
/db_xref="dbSNP:1208433606"
variation 13
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:746814799"
variation 14
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:564323934"
variation 15
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:557219694"
variation 18
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:760260709"
variation 19
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1305515820"
variation 20
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:750063201"
variation 22
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314407450"
variation 23
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:778523465"
variation 24
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:756793908"
variation 25
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1014873419"
variation 26
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768129180"
variation 28
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320148805"
variation 29
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="t"
/db_xref="dbSNP:760031880"
variation 37
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161087346"
variation 38..43
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="aag"
/replace="aagaag"
/db_xref="dbSNP:1200749565"
variation 39
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:751887605"
variation 40
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766669262"
variation 41..48
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="aagt"
/replace="aagtaagt"
/db_xref="dbSNP:747791358"
variation 43
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:763188281"
ncRNA 44..66
/ncRNA_class="miRNA"
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/product="hsa-miR-302a-3p"
/db_xref="miRBase:MIMAT0000684"
/db_xref="GeneID:407028"
/db_xref="HGNC:HGNC:31623"
/db_xref="MIM:614596"
/db_xref="miRBase:MI0000738"
variation 44
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="t"
/db_xref="dbSNP:2048449137"
variation 45
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:2048448897"
variation 46
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1578606721"
variation 48
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238947970"
variation 51
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:1445937850"
variation 56
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="t"
/db_xref="dbSNP:2048447596"
variation 57
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:773454900"
variation 65
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248366287"
variation 69
/gene="MIR302A"
/gene_synonym="hsa-mir-302; mir-302a; MIRN302; MIRN302A"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770044270"
ORIGIN
ccaccacttaaacgtggatgtacttgctttgaaactaaagaagtaagtgcttccatgttttggtgatgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]