GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-18 11:41:31, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NR_029489                 82 bp    RNA     linear   PRI 11-SEP-2024
DEFINITION  Homo sapiens microRNA 19a (MIR19A), microRNA.
ACCESSION   NR_029489
VERSION     NR_029489.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 82)
  AUTHORS   Luo,J., Wang,L., Cui,C., Chen,H., Zeng,W. and Li,X.
  TITLE     MicroRNA-19a-3p inhibits endothelial dysfunction in atherosclerosis
            by targeting JCAD
  JOURNAL   BMC Cardiovasc Disord 24 (1), 394 (2024)
   PUBMED   39080547
  REMARK    GeneRIF: MicroRNA-19a-3p inhibits endothelial dysfunction in
            atherosclerosis by targeting JCAD.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 82)
  AUTHORS   Fernandez-Sanjurjo,M., Pinto-Hernandez,P., Davalos,A.,
            Diaz-Martinez,A.E., Martin-Hernandez,R., Castilla-Silgado,J.,
            Toyos-Rodriguez,C., Whitham,M., Amado-Rodriguez,L.,
            Muniz-Albaiceta,G., Terrados,N., Fernandez-Garcia,B. and
            Iglesias-Gutierrez,E.
  TITLE     Next-generation sequencing reveals that miR-16-5p, miR-19a-3p,
            miR-451a, and miR-25-3p cargo in plasma extracellular vesicles
            differentiates sedentary young males from athletes
  JOURNAL   Eur J Sport Sci 24 (6), 766-776 (2024)
   PUBMED   38874986
  REMARK    GeneRIF: Next-generation sequencing reveals that miR-16-5p,
            miR-19a-3p, miR-451a, and miR-25-3p cargo in plasma extracellular
            vesicles differentiates sedentary young males from athletes.
REFERENCE   3  (bases 1 to 82)
  AUTHORS   Chen,H., Li,X., Chen,W., Wu,T. and Liu,S.
  TITLE     LncRNA HOTAIR Inhibits miR-19a-3p to Alleviate Foam Cell Formation
            and Inflammatory Response in Atherosclerosis
  JOURNAL   Int J Med Sci 21 (3), 521-529 (2024)
   PUBMED   38250607
  REMARK    GeneRIF: LncRNA HOTAIR Inhibits miR-19a-3p to Alleviate Foam Cell
            Formation and Inflammatory Response in Atherosclerosis.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 82)
  AUTHORS   Yang,X., Luo,Y., Li,M., Jin,Z., Chen,G. and Gan,C.
  TITLE     Long non-coding RNA NBR2 suppresses the progression of colorectal
            cancer by downregulating miR-19a to regulate M2 macrophage
            polarization
  JOURNAL   Chin J Physiol 66 (6), 546-557 (2023)
   PUBMED   38149567
  REMARK    GeneRIF: Long non-coding RNA NBR2 suppresses the progression of
            colorectal cancer by downregulating miR-19a to regulate M2
            macrophage polarization.
REFERENCE   5  (bases 1 to 82)
  AUTHORS   Du,L., Dou,K., Zhang,D., Xia,H., Liang,N., Wang,N., Sun,J. and
            Bai,R.
  TITLE     MiR-19a-3p Promotes Aerobic Glycolysis in Ovarian Cancer Cells via
            IGFBP3/PI3K/AKT Pathway
  JOURNAL   Folia Biol (Praha) 69 (5-6), 163-172 (2023)
   PUBMED   38583177
  REMARK    GeneRIF: MiR-19a-3p Promotes Aerobic Glycolysis in Ovarian Cancer
            Cells via IGFBP3/PI3K/AKT Pathway.
REFERENCE   6  (bases 1 to 82)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   7  (bases 1 to 82)
  AUTHORS   Ota,A., Tagawa,H., Karnan,S., Tsuzuki,S., Karpas,A., Kira,S.,
            Yoshida,Y. and Seto,M.
  TITLE     Identification and characterization of a novel gene, C13orf25, as a
            target for 13q31-q32 amplification in malignant lymphoma
  JOURNAL   Cancer Res 64 (9), 3087-3095 (2004)
   PUBMED   15126345
REFERENCE   8  (bases 1 to 82)
  AUTHORS   Dostie,J., Mourelatos,Z., Yang,M., Sharma,A. and Dreyfuss,G.
  TITLE     Numerous microRNPs in neuronal cells containing novel microRNAs
  JOURNAL   RNA 9 (2), 180-186 (2003)
   PUBMED   12554860
  REMARK    Erratum:[RNA. 2003 May;9(5):631-2]
REFERENCE   9  (bases 1 to 82)
  AUTHORS   Mourelatos,Z., Dostie,J., Paushkin,S., Sharma,A., Charroux,B.,
            Abel,L., Rappsilber,J., Mann,M. and Dreyfuss,G.
  TITLE     miRNPs: a novel class of ribonucleoproteins containing numerous
            microRNAs
  JOURNAL   Genes Dev 16 (6), 720-728 (2002)
   PUBMED   11914277
REFERENCE   10 (bases 1 to 82)
  AUTHORS   Lagos-Quintana,M., Rauhut,R., Lendeckel,W. and Tuschl,T.
  TITLE     Identification of novel genes coding for small expressed RNAs
  JOURNAL   Science 294 (5543), 853-858 (2001)
   PUBMED   11679670
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL162375.24.
            This sequence is a reference standard in the RefSeqGene project.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM608162.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-82                AL162375.24        23217-23298
FEATURES             Location/Qualifiers
     source          1..82
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="13"
                     /map="13q31.3"
     gene            1..82
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /note="microRNA 19a"
                     /db_xref="GeneID:406979"
                     /db_xref="HGNC:HGNC:31574"
                     /db_xref="MIM:609418"
                     /db_xref="miRBase:MI0000073"
     precursor_RNA   1..82
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /product="microRNA 19a"
                     /db_xref="GeneID:406979"
                     /db_xref="HGNC:HGNC:31574"
                     /db_xref="MIM:609418"
                     /db_xref="miRBase:MI0000073"
     exon            1..82
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1594014031"
     variation       2
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750595412"
     variation       6
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2501246793"
     variation       7..10
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:761092550"
     variation       7
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477297925"
     variation       9
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168187778"
     variation       10..12
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1875275146"
     variation       10
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2501246842"
     ncRNA           14..35
                     /ncRNA_class="miRNA"
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /product="hsa-miR-19a-5p"
                     /db_xref="miRBase:MIMAT0004490"
                     /db_xref="GeneID:406979"
                     /db_xref="HGNC:HGNC:31574"
                     /db_xref="MIM:609418"
                     /db_xref="miRBase:MI0000073"
     variation       14
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1875275359"
     variation       15
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756288295"
     variation       16
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566344357"
     variation       18
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1875275939"
     variation       19
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051963210"
     variation       20
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1875276298"
     variation       21
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780315531"
     variation       22
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162564162"
     variation       24
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2501246925"
     variation       26
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170543143"
     variation       28
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388542964"
     variation       31
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442807536"
     variation       33
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403138754"
     variation       35..42
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:764765453"
     variation       36
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341300736"
     variation       38
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2501247020"
     variation       40
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2501247031"
     variation       46
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399638017"
     variation       47
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2501247050"
     ncRNA           49..71
                     /ncRNA_class="miRNA"
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /product="hsa-miR-19a-3p"
                     /db_xref="miRBase:MIMAT0000073"
                     /db_xref="GeneID:406979"
                     /db_xref="HGNC:HGNC:31574"
                     /db_xref="MIM:609418"
                     /db_xref="miRBase:MI0000073"
     variation       49
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750154321"
     variation       51..66
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="tgcaaa"
                     /replace="tgcaaatctatgcaaa"
                     /db_xref="dbSNP:2501247069"
     variation       52
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749350150"
     variation       53
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1875278335"
     variation       55
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890231900"
     variation       58
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323869733"
     variation       60
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182598123"
     variation       67
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755092873"
     variation       68
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265327793"
     variation       70
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778783279"
     variation       71
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748058730"
     variation       72..77
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="tgg"
                     /replace="tggtgg"
                     /db_xref="dbSNP:1875279684"
     variation       72
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771832462"
     variation       77
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772879142"
     variation       78
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993053169"
     variation       80
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257895319"
     variation       82
                     /gene="MIR19A"
                     /gene_synonym="C13orf25; hsa-mir-19a; miR-19a; MIR17HG;
                     MIRH1; MIRHG1; MIRN19A; miRNA19A"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374554651"
ORIGIN      
gcagtcctctgttagttttgcatagttgcactacaagaagaatgtagttgtgcaaatctatgcaaaactgatggtggcctgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]