LOCUS       NM_001410927            2229 bp    mRNA    linear   PRI 01-JAN-2023
DEFINITION  Homo sapiens LIM homeobox 9 (LHX9), transcript variant 4, mRNA.
ACCESSION   NM_001410927 XM_005245350
VERSION     NM_001410927.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2229)
  AUTHORS   Okutomo K, Fujino N, Yamada M, Saito T, Ono Y, Okada Y, Ichinose M
            and Sugiura H.
  TITLE     Increased LHX9 expression in alveolar epithelial type 2 cells of
            patients with chronic obstructive pulmonary disease
  JOURNAL   Respir Investig 60 (1), 119-128 (2022)
   PUBMED   34548271
  REMARK    GeneRIF: Increased LHX9 expression in alveolar epithelial type 2
            cells of patients with chronic obstructive pulmonary disease.
REFERENCE   2  (bases 1 to 2229)
  AUTHORS   Luo X, Ge J, Chen T, Liu J, Liu Z, Bi C and Lan S.
  TITLE     LHX9, a p53-binding protein, inhibits the progression of glioma by
            suppressing glycolysis
  JOURNAL   Aging (Albany NY) 13 (18), 22109-22119 (2021)
   PUBMED   34536269
  REMARK    GeneRIF: LHX9, a p53-binding protein, inhibits the progression of
            glioma by suppressing glycolysis.
REFERENCE   3  (bases 1 to 2229)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   4  (bases 1 to 2229)
  AUTHORS   Hu F, Zhu Q, Sun B, Cui C, Li C and Zhang L.
  TITLE     Smad ubiquitylation regulatory factor 1 promotes LIM-homeobox gene
            9 degradation and represses testosterone production in Leydig cells
  JOURNAL   FASEB J 32 (9), 4627-4640 (2018)
   PUBMED   29565736
  REMARK    GeneRIF: that Smurf1 promotes Lhx9 ubiquitylation and is involved
            in testosterone production in Leydig cells directly
REFERENCE   5  (bases 1 to 2229)
  AUTHORS   Yin Y, Morgunova E, Jolma A, Kaasinen E, Sahu B, Khund-Sayeed S,
            Das PK, Kivioja T, Dave K, Zhong F, Nitta KR, Taipale M, Popov A,
            Ginno PA, Domcke S, Yan J, Schubeler D, Vinson C and Taipale J.
  TITLE     Impact of cytosine methylation on DNA binding specificities of
            human transcription factors
  JOURNAL   Science 356 (6337) (2017)
   PUBMED   28473536
REFERENCE   6  (bases 1 to 2229)
  AUTHORS   Vaquerizas JM, Kummerfeld SK, Teichmann SA and Luscombe NM.
  TITLE     A census of human transcription factors: function, expression and
            evolution
  JOURNAL   Nat Rev Genet 10 (4), 252-263 (2009)
   PUBMED   19274049
  REMARK    Review article
REFERENCE   7  (bases 1 to 2229)
  AUTHORS   Barrios-Rodiles M, Brown KR, Ozdamar B, Bose R, Liu Z, Donovan RS,
            Shinjo F, Liu Y, Dembowy J, Taylor IW, Luga V, Przulj N, Robinson
            M, Suzuki H, Hayashizaki Y, Jurisica I and Wrana JL.
  TITLE     High-throughput mapping of a dynamic signaling network in mammalian
            cells
  JOURNAL   Science 307 (5715), 1621-1625 (2005)
   PUBMED   15761153
REFERENCE   8  (bases 1 to 2229)
  AUTHORS   Ottolenghi C, Moreira-Filho C, Mendonca BB, Barbieri M, Fellous M,
            Berkovitz GD and McElreavey K.
  TITLE     Absence of mutations involving the LIM homeobox domain gene LHX9 in
            46,XY gonadal agenesis and dysgenesis
  JOURNAL   J Clin Endocrinol Metab 86 (6), 2465-2469 (2001)
   PUBMED   11397841
REFERENCE   9  (bases 1 to 2229)
  AUTHORS   Retaux S, Rogard M, Bach I, Failli V and Besson MJ.
  TITLE     Lhx9: a novel LIM-homeodomain gene expressed in the developing
            forebrain
  JOURNAL   J Neurosci 19 (2), 783-793 (1999)
   PUBMED   9880598
REFERENCE   10 (bases 1 to 2229)
  AUTHORS   Adams MD, Kerlavage AR, Fleischmann RD, Fuldner RA, Bult CJ, Lee
            NH, Kirkness EF, Weinstock KG, Gocayne JD, White O et al.
  TITLE     Initial assessment of human gene diversity and expression patterns
            based upon 83 million nucleotides of cDNA sequence
  JOURNAL   Nature 377 (6547 Suppl), 3-174 (1995)
   PUBMED   7566098
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL590115.7.
            
            On Aug 18, 2022 this sequence version replaced XM_005245350.4.
            
            Summary: This gene encodes a member of the LIM homeobox gene family
            of developmentally expressed transcription factors. The encoded
            protein contains a homeodomain and two cysteine-rich zinc-binding
            LIM domains involved in protein-protein interactions. The protein
            is highly similar to a mouse protein that causes gonadal agenesis
            when inactivated, suggesting a role in gonadal development.
            Alternative splicing results in multiple transcript variants.
            [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR14038193.2420349.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2148093, SAMEA2148874
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-678               AL590115.7         136875-137552
            679-797             AL590115.7         138680-138798
            798-1000            AL590115.7         140773-140975
            1001-1356           AL590115.7         142105-142460
            1357-1559           AL590115.7         148392-148594
            1560-2229           AL590115.7         152720-153389
FEATURES             Location/Qualifiers
     source          1..2229
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q31.3"
     gene            1..2229
                     /gene="LHX9"
                     /note="LIM homeobox 9"
                     /db_xref="GeneID:56956"
                     /db_xref="HGNC:HGNC:14222"
                     /db_xref="MIM:606066"
     exon            1..678
                     /gene="LHX9"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    600..602
                     /gene="LHX9"
                     /note="upstream in-frame stop codon"
     CDS             606..1616
                     /gene="LHX9"
                     /note="isoform 4 is encoded by transcript variant 4;
                     LIM/homeobox protein Lhx9; LIM homeobox protein 9"
                     /codon_start=1
                     /product="LIM/homeobox protein Lhx9 isoform 4"
                     /protein_id="NP_001397856.1"
                     /db_xref="CCDS:CCDS91139.1"
                     /db_xref="GeneID:56956"
                     /db_xref="HGNC:HGNC:14222"
                     /db_xref="MIM:606066"
                     /translation="

MQTLQTPSPLRMKPASSRVSGPQEAMLFHGISGGHIQGIMEEMERRSKTEARLAKGAQLNGRDAGMPPLSPEKPALCAGCGGKISDRYYLLAVDKQWHLRCLKCCECKLALESELTCFAKDGSIYCKEDYYRRFSVQRCARCHLGISASEMVMRARDSVYHLSCFTCSTCNKTLTTGDHFGMKDSLVYCRAHFETLLQGEYPPQLSYTELAAKSGGLALPYFNGTGTVQKGRPRKRKSPALGVDIVNYNSGCNENEADHLDRDQQPYPPSQKTKRMRTSFKHHQLRTMKSYFAINHNPDAKDLKQLAQKTGLTKRVLQGEQILGHYSQTSRRLKIP"

     misc_feature    804..995
                     /gene="LHX9"
                     /note="The first LIM domain of Lhx2; Region: LIM1_Lhx2;
                     cd09469"
                     /db_xref="CDD:188853"
     misc_feature    order(834..836,843..845,897..899,906..908,915..917,
                     924..926,981..983,990..992)
                     /gene="LHX9"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188853"
     misc_feature    1008..1184
                     /gene="LHX9"
                     /note="The second LIM domain of Lhx2 and Lhx9 family;
                     Region: LIM2_Lhx2_Lhx9; cd09377"
                     /db_xref="CDD:188763"
     misc_feature    order(1020..1022,1029..1031,1086..1088,1095..1097,
                     1104..1106,1113..1115,1170..1172,1179..1181)
                     /gene="LHX9"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188763"
     misc_feature    1422..>1559
                     /gene="LHX9"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     exon            679..797
                     /gene="LHX9"
                     /inference="alignment:Splign:2.1.0"
     exon            798..1000
                     /gene="LHX9"
                     /inference="alignment:Splign:2.1.0"
     exon            1001..1356
                     /gene="LHX9"
                     /inference="alignment:Splign:2.1.0"
     exon            1357..1559
                     /gene="LHX9"
                     /inference="alignment:Splign:2.1.0"
     exon            1560..2229
                     /gene="LHX9"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1945..1950
                     /regulatory_class="polyA_signal_sequence"
                     /gene="LHX9"
                     /note="hexamer: AATAAA"
     polyA_site      1969
                     /gene="LHX9"
     regulatory      2207..2212
                     /regulatory_class="polyA_signal_sequence"
                     /gene="LHX9"
                     /note="hexamer: AATAAA"
     polyA_site      2229
                     /gene="LHX9"
                     /note="major polyA site"
ORIGIN      

ggaaggaacagagagcggccggcgcgtcctcctctctgggtaaagccgcgttggttcctgccgcagcgctgtgcttcggactcctagggggcctctggccgtttgaatgaatcgacaatatcagagtattgtggacactttttaatggggccggggaggggccgccgctgccgagaactgagggcgacagaacaatcccacctcttgtgaggagcaggtctgccattctgcttgtcagttctcaccttcccctcctccacggcaaagagtccctttcacacccttctgagtgtgcgggtgcgcccagttttacaagtcctctgtcctgccagggtagtgggagaagcacgcgatggggctagcgcccagtcctgcgggggcaggcgccaagctcccgggagtccgcaagtcgcttcctatattggcaagcttcaaatgagacattagaatctccggcaaccttccttcaaacctgaaccggggaagagaataagccgccctatggccaaggcgcaattgcgtacccgtgtgtacaggtccatgccctgtcccctacactctaattttctcaaagaaaattgttttgccaaaagtaaccctgagaaatgcagacgctccaaacgccctctccacttcggatgaagccagcatctagtagggtctccggccctcaagaagccatgctctttcacgggatctccggaggccacatccaaggcatcatggaggagatggagcgcagatccaagactgaggcccgtctggccaaaggcgcccagctcaacggccgcgacgcgggcatgcccccgctcagcccggagaagcccgccctgtgcgccggctgcgggggcaagatctcggacaggtactatctgctggctgtggacaaacagtggcatctgagatgcctgaagtgctgtgaatgtaagctggccctcgagtccgagctcacctgctttgccaaggacggtagcatttactgcaaggaggattactacagaaggttctctgtgcagagatgtgcccgctgccaccttggcatttccgcctcggagatggtcatgcgcgcccgagactctgtctaccacctgagctgcttcacctgctccacttgcaacaagactctgaccacgggcgaccatttcggcatgaaggacagcctggtgtactgccgcgcccacttcgagaccctcttgcaaggagagtatccaccgcagctgagctacacggagctggcggccaagagcggcggcctggccctgccttacttcaacggtacgggcaccgtgcagaaagggcggccccggaagcggaagagcccagcgctgggagtggacatcgtcaattacaactcaggttgtaatgagaatgaggcagaccacttggaccgggaccagcagccttatccaccctcgcagaagaccaagcgcatgcgaacctctttcaagcatcaccagctccggaccatgaaatcctactttgccatcaaccacaacccggatgccaaggacctcaagcagcttgcccagaaaacaggtctgaccaaaagagttttgcagggagaacaaatcttggggcattacagccaaacatcccgacgtttgaaaattccctaaagtattaaaagaaggggaaaagtttgatcggaaatccactgcagtgaagacaaagacactattaggttatgataatcatacattaaaaaatttattaagccaaaaaaaaagagagagagagagacttaaatgtcatttactgaatgttaacgaaacttgtgttctttatggtgtctaacacaactgaaggcctaaaattatgtggtttaaacaaaattagataaaccatgtacaaaaccagagcaacctggcagtaatatgcccaccccatatttgaaaaaaattattattgaaaaaaatttcacacatttgtcaagcacagttgtaaaataaagtccaaaacattcatttcacctgcttgctaatgtgtattagtcctgttaatggcattttccaactgtaaattcaaagaaaagctatcacccatttaagagtatagggatcaaaccccagtaattttagcattattgtttatcacttcctttttaaacagaaatctctgcatgcacttttacatatgtcacctctagtgtacacctctgtatgatgacttatctttgctgtttcttgtatgataaatagctttcattaataaacatttatttgatgcaaa

//