ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-02 15:19:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001400027 8151 bp mRNA linear PRI 01-JAN-2023
DEFINITION Homo sapiens ATPase phospholipid transporting 8A1 (ATP8A1),
transcript variant 6, mRNA.
ACCESSION NM_001400027 XM_017007647
VERSION NM_001400027.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 8151)
AUTHORS Kook S, Wang P, Meng S, Jetter CS, Sucre JMS, Benjamin JT, Gokey
JJ, Hanby HA, Jaume A, Goetzl L, Marks MS and Guttentag SH.
TITLE AP-3-dependent targeting of flippase ATP8A1 to lamellar bodies
suppresses activation of YAP in alveolar epithelial type 2 cells
JOURNAL Proc Natl Acad Sci U S A 118 (20) (2021)
PUBMED 33990468
REMARK GeneRIF: AP-3-dependent targeting of flippase ATP8A1 to lamellar
bodies suppresses activation of YAP in alveolar epithelial type 2
cells.
REFERENCE 2 (bases 1 to 8151)
AUTHORS Hiraizumi M, Yamashita K, Nishizawa T and Nureki O.
TITLE Cryo-EM structures capture the transport cycle of the P4-ATPase
flippase
JOURNAL Science 365 (6458), 1149-1155 (2019)
PUBMED 31416931
REMARK GeneRIF: cryo-electron microscopy structure of six intermediates of
the human flippase ATP8A1 bound to the partner protein CDC50a; ATP
binding and autophosphorylation of ATP8A1 drive a cycle of
conformations in which lipids bind differently, powering
translocation.
REFERENCE 3 (bases 1 to 8151)
AUTHORS Dizier MH, Margaritte-Jeannin P, Pain L, Sarnowski C, Brossard M,
Mohamdi H, Lavielle N, Babron MC, Just J, Lathrop M, Laprise C,
Bouzigon E, Demenais F and Nadif R.
TITLE Interactive effect between ATPase-related genes and early-life
tobacco smoke exposure on bronchial hyper-responsiveness detected
in asthma-ascertained families
JOURNAL Thorax 74 (3), 254-260 (2019)
PUBMED 30282721
REMARK GeneRIF: Single-nucleotide polymorphism, rs17448506, located in
ATP8A1 intron, reached the significance threshold for interaction
with tobacco smoke expose and bronchial hyperresponsiveness
(p=10-5).
REFERENCE 4 (bases 1 to 8151)
AUTHORS Jing W, Yabas M, Broer A, Coupland L, Gardiner EE, Enders A and
Broer S.
TITLE Calpain cleaves phospholipid flippase ATP8A1 during apoptosis in
platelets
JOURNAL Blood Adv 3 (3), 219-229 (2019)
PUBMED 30674456
REMARK GeneRIF: ATP8A1 is cleaved by the cysteine protease calpain during
apoptosis, and the cleavage is prevented indirectly by caspase
inhibition, involving blockage of calcium influx into platelets and
subsequent calpain activation.
REFERENCE 5 (bases 1 to 8151)
AUTHORS Li Q, Yang Y and Liu Y.
TITLE Over-Expression of ATPase II Alleviates Ethanol-Induced Hepatocyte
Injury in HL-7702 Cells
JOURNAL Med Sci Monit 24, 8372-8382 (2018)
PUBMED 30457983
REMARK GeneRIF: Over-expression of ATP8A1 alleviated ethanol-induced
hepatocyte injury. Moreover, the PI3K/Akt signaling pathway appears
to participate in inhibition of ethanol-induced hepatocyte
apoptosis.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 8151)
AUTHORS Paulusma CC and Oude Elferink RP.
TITLE The type 4 subfamily of P-type ATPases, putative aminophospholipid
translocases with a role in human disease
JOURNAL Biochim Biophys Acta 1741 (1-2), 11-24 (2005)
PUBMED 15919184
REMARK Review article
REFERENCE 7 (bases 1 to 8151)
AUTHORS Kuhlbrandt W.
TITLE Biology, structure and mechanism of P-type ATPases
JOURNAL Nat Rev Mol Cell Biol 5 (4), 282-295 (2004)
PUBMED 15071553
REMARK Review article
REFERENCE 8 (bases 1 to 8151)
AUTHORS Halleck MS, Lawler JF JR, Blackshaw S, Gao L, Nagarajan P, Hacker
C, Pyle S, Newman JT, Nakanishi Y, Ando H, Weinstock D, Williamson
P and Schlegel RA.
TITLE Differential expression of putative transbilayer amphipath
transporters
JOURNAL Physiol Genomics 1 (3), 139-150 (1999)
PUBMED 11015572
REMARK Publication Status: Online-Only
REFERENCE 9 (bases 1 to 8151)
AUTHORS Mouro I, Halleck MS, Schlegel RA, Mattei MG, Williamson P,
Zachowski A, Devaux P, Cartron JP and Colin Y.
TITLE Cloning, expression, and chromosomal mapping of a human ATPase II
gene, member of the third subfamily of P-type ATPases and
orthologous to the presumed bovine and murine aminophospholipid
translocase
JOURNAL Biochem Biophys Res Commun 257 (2), 333-339 (1999)
PUBMED 10198212
REFERENCE 10 (bases 1 to 8151)
AUTHORS Halleck MS, Pradhan D, Blackman C, Berkes C, Williamson P and
Schlegel RA.
TITLE Multiple members of a third subfamily of P-type ATPases identified
by genomic sequences and ESTs
JOURNAL Genome Res 8 (4), 354-361 (1998)
PUBMED 9548971
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC096734.3, AC139717.1,
AC110788.3 and AC084010.6.
On Jan 19, 2022 this sequence version replaced XM_017007647.1.
Summary: The P-type adenosinetriphosphatases (P-type ATPases) are a
family of proteins which use the free energy of ATP hydrolysis to
drive uphill transport of ions across membranes. Several
subfamilies of P-type ATPases have been identified. One subfamily
catalyzes transport of heavy metal ions. Another subfamily
transports non-heavy metal ions (NMHI). The protein encoded by this
gene is a member of the third subfamily of P-type ATPases and acts
to transport amphipaths, such as phosphatidylserine. Two transcript
variants encoding different isoforms have been found for this gene.
[provided by RefSeq, Jul 2008].
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: SRR14038196.1140966.1,
SRR14038193.2501732.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA1965299,
SAMEA1966682 [ECO:0006172]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-281 AC096734.3 22766-23046 c
282-396 AC139717.1 60701-60815 c
397-496 AC139717.1 59320-59419 c
497-595 AC139717.1 58242-58340 c
596-641 AC139717.1 49739-49784 c
642-682 AC139717.1 34184-34224 c
683-752 AC139717.1 21966-22035 c
753-880 AC139717.1 20055-20182 c
881-992 AC139717.1 15327-15438 c
993-1158 AC139717.1 13519-13684 c
1159-1286 AC139717.1 11966-12093 c
1287-1364 AC139717.1 9328-9405 c
1365-1453 AC139717.1 8325-8413 c
1454-1526 AC110788.3 68440-68512 c
1527-1632 AC110788.3 64977-65082 c
1633-1715 AC110788.3 63670-63752 c
1716-1765 AC110788.3 61485-61534 c
1766-1835 AC110788.3 56389-56458 c
1836-1920 AC110788.3 37235-37319 c
1921-2060 AC110788.3 34632-34771 c
2061-2199 AC110788.3 19488-19626 c
2200-2264 AC110788.3 15922-15986 c
2265-2437 AC084010.6 83542-83714 c
2438-2621 AC084010.6 62939-63122 c
2622-2732 AC084010.6 62736-62846 c
2733-2807 AC084010.6 53571-53645 c
2808-2930 AC084010.6 53343-53465 c
2931-3009 AC084010.6 50027-50105 c
3010-3071 AC084010.6 44629-44690 c
3072-3128 AC084010.6 42624-42680 c
3129-3236 AC084010.6 41611-41718 c
3237-3325 AC084010.6 21663-21751 c
3326-3418 AC084010.6 20853-20945 c
3419-3510 AC084010.6 12673-12764 c
3511-8151 AC084010.6 6419-11059 c
FEATURES Location/Qualifiers
source 1..8151
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="4"
/map="4p13"
gene 1..8151
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/note="ATPase phospholipid transporting 8A1"
/db_xref="GeneID:10396"
/db_xref="HGNC:HGNC:13531"
/db_xref="MIM:609542"
exon 1..281
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1196176428"
variation 2
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1450367898"
variation 3
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:569178122"
variation 5
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:992235016"
variation 6
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:990873149"
variation 7
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:952758270"
variation 8
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027092734"
variation 9
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1391820004"
variation 10
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:898717218"
variation 11
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1244019690"
variation 12
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741728193"
variation 13
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1317294780"
variation 14
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:865849700"
variation 15
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741727354"
variation 16
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1250057558"
variation 17
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1481905095"
variation 18
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196792865"
variation 19..30
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gcgggcgccgcc"
/replace="gcgggcgccgccgcgggcgccgcc"
/db_xref="dbSNP:952456159"
variation 19
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1242886956"
variation 20
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741726068"
variation 21
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741725825"
variation 22
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1442427654"
variation 23..34
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gcgccgccacct"
/replace="gcgccgccacctgcgccgccacct"
/db_xref="dbSNP:1403586709"
variation 23
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1184999497"
variation 24..45
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cgccgccacc"
/replace="cgccgccaccttcgccgccacc"
/replace="cgccgccaccttcgccgccaccttcgccgccacc"
/db_xref="dbSNP:1022617543"
variation 24
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1346063387"
variation 25
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1385323476"
variation 26
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:961602890"
variation 27
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1167693573"
variation 28..51
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gccaccttcgccgccaccgctgcc"
/replace="gccaccttcgccgccaccgctgccaccttcgccgccaccgctgcc"
/db_xref="dbSNP:1741718639"
variation 28
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741723830"
variation 29
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:549000300"
variation 31
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741722974"
variation 33
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1330401936"
variation 34
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1741722148"
variation 35
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1741721893"
variation 36
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:116622654"
variation 37
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:901611480"
variation 39
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1052238553"
variation 42
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:935177878"
variation 43
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:890095812"
variation 44..51
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cc"
/replace="ccgctgcc"
/db_xref="dbSNP:1741718382"
variation 44
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:566734535"
variation 45
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:995828741"
variation 46
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1741719124"
variation 48
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741718874"
variation 53
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:547140412"
variation 55..65
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ctcctcct"
/replace="ctcctcctcct"
/replace="ctcctcctcctcct"
/db_xref="dbSNP:1741716149"
variation 57
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1741717793"
variation 58
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741717533"
variation 59
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1414647995"
variation 61
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1237758647"
variation 63
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:866018394"
variation 64
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1053507267"
variation 67
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374636805"
variation 69
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1429084716"
variation 70
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1170240249"
variation 71
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741715022"
variation 72
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:992124768"
variation 74
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1741713855"
variation 76..80
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1741712956"
variation 76
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426960857"
variation 78
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741713383"
variation 79
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1429119655"
variation 80
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2109606894"
variation 83
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2109606883"
variation 84
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470796181"
variation 88
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:902346357"
variation 89
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741712132"
variation 90..92
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="gcg"
/db_xref="dbSNP:1473891118"
variation 90
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741711874"
variation 92
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:868540411"
variation 95
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:12503784"
variation 96
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:949342304"
variation 97
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741709621"
variation 100
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1204317389"
variation 104
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:916512271"
variation 107
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283126095"
variation 109
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:990798229"
variation 113
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:931339607"
variation 114..115
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1225794836"
variation 115..155
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gcggcgcggcccaggctgcagctgagcgctctgcgcggcgc"
/replace="gcggcgcggcccaggctgcagctgagcgctctgcgcggcgcggcccag
gctgcagctgagcgctctgcgcggcgc"
/db_xref="dbSNP:1287461134"
variation 116
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:920002636"
variation 117
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1198765246"
variation 120
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:972822288"
variation 121
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344410554"
variation 125
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1288848715"
variation 130
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1230144108"
variation 132
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741706303"
variation 133
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741706074"
variation 134
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:962934792"
variation 137
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1348596084"
variation 138
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741705201"
variation 139
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:961805781"
variation 142
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1198610305"
variation 143..146
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1741704164"
variation 143
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:531010134"
variation 147
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1741703928"
variation 151
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1481370197"
variation 153
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577803493"
variation 154
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1741703249"
variation 156
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1019800296"
variation 160
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:987431440"
variation 161
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741702183"
variation 166
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1400365957"
variation 167
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157117946"
variation 168
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1007177767"
variation 171
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741701175"
variation 174
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:954308706"
variation 176
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741700305"
variation 180
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741700073"
variation 181
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1326183542"
variation 182
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1442566803"
variation 183
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741699371"
variation 185
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:753010928"
variation 187
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:765342798"
variation 188
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1407259325"
variation 189
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:760016306"
variation 192
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741698105"
variation 193
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741697866"
variation 194
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1372998462"
variation 195
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:776849680"
variation 197
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1174126566"
variation 199
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741696969"
variation 200..207
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="cgggctga"
/db_xref="dbSNP:1253644031"
variation 200
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741696736"
variation 201
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1453860084"
variation 203
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:901580296"
variation 206
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:995796084"
variation 210
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1195742465"
variation 211
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:766676803"
variation 212
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1288932947"
variation 213
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1741694798"
variation 215
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1490828943"
variation 216
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1741694331"
variation 218
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1741694096"
variation 220
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248177541"
variation 221..231
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gccgccgc"
/replace="gccgccgccgc"
/db_xref="dbSNP:757525784"
variation 221
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:112235862"
variation 223
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1232103587"
variation 225
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468347359"
variation 227
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:773669395"
variation 229
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1577803186"
variation 231
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1741692413"
variation 232
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:903716778"
variation 233
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:902315618"
variation 236
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1346524406"
variation 240
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741691256"
variation 241
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303450447"
variation 242
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1236069791"
variation 244
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:771594320"
variation 245
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747590503"
variation 246
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1363752199"
variation 247
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:774117730"
variation 252
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1399327919"
variation 253
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741688669"
variation 254
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:947958934"
variation 261
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1311610553"
variation 265
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1741687551"
variation 267
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1046215312"
variation 268
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1395807916"
variation 271
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:542135277"
variation 272
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:748912126"
variation 274
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:779998642"
variation 276
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1741685320"
variation 278
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:755928734"
exon 282..396
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 283
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1738188906"
variation 289
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1441830125"
variation 290..291
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1738188138"
variation 293
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:762499364"
variation 296
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:775319750"
variation 297
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1408190547"
variation 298
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1738186212"
variation 302
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:769563866"
variation 303
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:759464653"
variation 307
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1738185154"
variation 308
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1738184635"
variation 309
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1479862702"
variation 310
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1738183726"
variation 313
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1738183335"
variation 323
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2109493254"
variation 325
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:367750346"
variation 329
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1738182643"
variation 330
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1250535482"
variation 331
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1393821352"
variation 332
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:770697673"
variation 333
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1408276957"
variation 335
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1738180861"
variation 337
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201503015"
variation 346
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1738179315"
variation 346
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1738179825"
variation 347
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023130054"
variation 351
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202829428"
variation 353
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:777718313"
variation 354
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1455026403"
variation 357
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274302894"
variation 362..365
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cc"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:751111217"
variation 362
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231179826"
variation 363
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1738176760"
variation 364
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1345820864"
variation 366
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560535364"
variation 370
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:16854624"
variation 379
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1738174232"
variation 385
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2109492985"
variation 388
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1235331309"
variation 389
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:749336580"
variation 390
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1295113995"
variation 392
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1738172868"
variation 395
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1738172506"
exon 397..496
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 399
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1372352884"
variation 400
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1279881723"
variation 403..406
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1373514705"
variation 404
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1737993309"
variation 406
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:760496808"
variation 410
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1381206631"
variation 411
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:773064827"
variation 412
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:772044738"
variation 413
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:147391791"
variation 415
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:775551182"
variation 420
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1737990520"
variation 421
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:769824158"
variation 424
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368745947"
variation 425
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1184759390"
variation 430
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1474536606"
variation 432
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:866499854"
variation 433
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:781449081"
variation 435
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1188826162"
variation 437
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1737987240"
variation 442
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:267600161"
variation 443
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1484287956"
variation 445
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1258974152"
variation 446
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:757599294"
variation 447
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:747391880"
variation 451
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:778199278"
variation 456
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398719376"
variation 461
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1737984029"
variation 463
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2109487860"
variation 470..475
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttttt"
/replace="tttttt"
/db_xref="dbSNP:750286033"
variation 470
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2109487854"
variation 481
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374248382"
variation 482
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1353545932"
variation 484
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:758989433"
variation 485
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1737982293"
variation 492
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1396467319"
variation 493
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1737981590"
exon 497..595
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 499
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1737844341"
variation 500
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1392030825"
variation 507
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:754575889"
variation 508
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:753385212"
variation 516
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2109483837"
variation 524
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:766007748"
variation 525
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:755793968"
variation 527
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233662377"
variation 528
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:750002357"
variation 531
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150108510"
variation 532
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:767320927"
variation 536
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:761573468"
variation 537
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1472543841"
variation 541
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342265961"
variation 550
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161514893"
variation 559
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299133220"
variation 565
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1737838653"
variation 567
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1737838102"
variation 570
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:774308531"
variation 571
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1416001388"
variation 572
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1737837320"
variation 573
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1737837055"
variation 577
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1737836765"
variation 581
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1462445169"
variation 587
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2109483666"
variation 590
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2109483657"
variation 593
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1737835974"
variation 595
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:764010144"
exon 596..641
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 599
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1372912447"
variation 600
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372884316"
variation 602
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:923164445"
variation 603
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1173906440"
variation 604
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370276735"
variation 609
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:751340917"
variation 610
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1736881082"
variation 610
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:778349622"
variation 613
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1451850749"
variation 614
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1361876893"
variation 617
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1736880044"
variation 622
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:866627138"
variation 624
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:113685514"
variation 634..635
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:866283270"
variation 636
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373363487"
variation 637
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:866402689"
exon 642..682
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
misc_feature 645..647
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/note="upstream in-frame stop codon"
CDS 651..3608
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/EC_number="7.6.2.1"
/note="isoform f is encoded by transcript variant 6;
ATPase II; aminophospholipid translocase; probable
phospholipid-transporting ATPase IA; chromaffin granule
ATPase II; ATPase class I type 8A member 1; P4-ATPase
flippase complex alpha subunit ATP8A1; ATPase,
aminophospholipid transporter (APLT), class I, type 8A,
member 1"
/codon_start=1
/product="phospholipid-transporting ATPase IA isoform f"
/protein_id="NP_001386956.1"
/db_xref="GeneID:10396"
/db_xref="HGNC:HGNC:13531"
/db_xref="MIM:609542"
/translation="
MVLGKLSTGKSEPQAMCYIETSNLDGETNLKIRQGLPATSDIKDVDSLMRISGRIECESPNRHLYDFVGNIRLDGHGTVPLGADQILLRGAQLRNTQWVHGIVVYTGHDTKLMQNSTSPPLKLSNVERITNVQILILFCILIAMSLVCSVGSAIWNRRHSGKDWYLNLNYGGASNFGLNFLTFIILFNNLIPISLLVTLEVVKFTQAYFINWDLDMHYEPTDTAAMARTSNLNEELGQVKYIFSDKTGTLTCNVMQFKKCTIAGVAYGQNSQFGDEKTFSDSSLLENLQNNHPTAPIICEFLTMMAVCHTAVPEREGDKIIYQAASPDEGALVRAAKQLNFVFTGRTPDSVIIDSLGQEERYELLNVLEFTSARKRMSVIVRTPSGKLRLYCKGADTVIYDRLAETSKYKEITLKHLEQFATEGLRTLCFAVAEISESDFQEWRAVYQRASTSVQNRLLKLEESYELIEKNLQLLGATAIEDKLQDQVPETIETLMKADIKIWILTGDKQETAINIGHSCKLLKKNMGMIVINEGSLDGTRETLSRHCTTLGDALRKENDFALIIDGKTLKYALTFGVRQYFLDLALSCKAVICCRVSPLQKSEVVEMVKKQVKVVTLAIGDGANDVSMIQTAHVGVGISGNEGLQAANSSDYSIAQFKYLKNLLMIHGAWNYNRVSKCILYCFYKNIVLYIIEIWFAFVNGFSGQILFERWCIGLYNVMFTAMPPLTLGIFERSCRKENMLKYPELYKTSQNALDFNTKVFWVHCLNGLFHSVILFWFPLKALQYGTAFGNGKTSDYLLLGNFVYTFVVITVCLKAGLETSYWTWFSHIAIWGSIALWVVFFGIYSSLWPAIPMAPDMSGEAAMLFSSGVFWMGLLFIPVASLLLDVVYKVIKRTAFKTLVDEVQELEAKSQDPGAVVLGKSLTERAQLLKNVFKKNHVNLYRSESLQQNLLHGYAFSQDENGIVSQSEVIRAYDTTKQRPDEW"
misc_feature 651..3371
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/note="phospholipid-translocating P-type ATPase, flippase;
Region: ATPase-Plipid; TIGR01652"
/db_xref="CDD:273734"
variation 652
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:758081743"
variation 653
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1233238834"
variation 655
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1420491897"
variation 663..665
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1173146831"
variation 664
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1177653895"
variation 665
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357649471"
variation 667
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1735137551"
variation 669
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1230778249"
variation 670
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:752730943"
variation 676
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1286072432"
variation 678
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:765054539"
variation 680
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1158617490"
variation 681
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1735135234"
exon 683..752
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 686
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:753995976"
variation 689
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191462948"
variation 691
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368395818"
variation 692
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:780431891"
variation 693
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:756455196"
variation 697
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1366113669"
variation 702
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1733830804"
variation 703
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1168001629"
variation 705
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:750943385"
variation 719
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1392240458"
variation 722
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1733829527"
variation 723
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1429075930"
variation 724
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1467561426"
variation 724
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1214465616"
variation 725
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1733828232"
variation 734
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2109361212"
variation 735
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:768061942"
variation 745
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1733827608"
variation 746
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1733827275"
variation 751
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733826937"
exon 753..880
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 756
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1249517491"
variation 758
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176388605"
variation 759
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:369714086"
variation 763..767
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ca"
/replace="caaca"
/db_xref="dbSNP:773859891"
variation 765
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143911156"
variation 766
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1483102071"
variation 767
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1441420555"
variation 769
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:756498988"
variation 775
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343807896"
variation 778
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:746228205"
variation 780
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560489480"
variation 781
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2109356466"
variation 782
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:781349727"
variation 783
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:757783790"
variation 784
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:752071925"
variation 790
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733621686"
variation 795
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1410933370"
variation 799
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1352430673"
variation 800
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1332249002"
variation 805
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1733620511"
variation 807
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377689629"
variation 816
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733619914"
variation 818
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1724582955"
variation 824
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733619629"
variation 826
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733619378"
variation 828
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:757956840"
variation 830
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752435918"
variation 837
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:972485894"
variation 838
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409409759"
variation 839
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1158379676"
variation 840
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1577648830"
variation 842
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1432611412"
variation 844
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1441054857"
variation 845
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:142811883"
variation 846
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1375156994"
variation 848
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:374505324"
variation 851
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1365070166"
variation 852
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:759308442"
variation 861
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:909681719"
variation 866
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1441543384"
variation 870
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1256435467"
variation 873
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1733614018"
variation 874
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:199606355"
variation 875
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226644255"
variation 877
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:766022679"
variation 878
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:770286939"
exon 881..992
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 881..886
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="caccgt"
/replace="caccgtcaccgt"
/db_xref="dbSNP:1733096381"
variation 881..884
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cacc"
/replace="caccacc"
/db_xref="dbSNP:1560484408"
variation 882
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404645973"
variation 884
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:775547433"
variation 885
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:551697810"
variation 891
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1164902594"
variation 894
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577638603"
variation 895
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:759826300"
variation 899
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:776695835"
variation 915
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1560484357"
variation 916
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1188738511"
variation 917
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733093988"
variation 921
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733093718"
variation 923
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1560484334"
variation 925
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1476598022"
variation 926
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:771366084"
variation 941
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:747372306"
variation 944
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:892258952"
variation 945..946
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="aaatacacagaaata"
/db_xref="dbSNP:1043510511"
variation 948
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1295212521"
variation 950
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:778482736"
variation 952
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733090618"
variation 953
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419523454"
variation 954
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:138921120"
variation 956
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:182056228"
variation 960
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1186710788"
variation 964
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:748598849"
variation 965
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:778516890"
variation 966
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:754401459"
variation 968
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000771627"
variation 969
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1163704293"
variation 970
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2109344810"
variation 972
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1733086938"
variation 973
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:753580416"
variation 975
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733086102"
variation 980
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:755973839"
variation 986
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:750229287"
variation 990
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369483216"
variation 992
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1733084397"
exon 993..1158
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 993
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:779268821"
variation 997
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443981394"
variation 999
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1732864835"
variation 1001
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1732864526"
variation 1002
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1303156480"
variation 1004
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:768256576"
variation 1007
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333019623"
variation 1010
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1415404855"
variation 1013
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1036745070"
variation 1016
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:748747364"
variation 1017
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:779555170"
variation 1019
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472537551"
variation 1023
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1412846087"
variation 1024
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1179020676"
variation 1028
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577633839"
variation 1031
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:755764711"
variation 1032
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374228770"
variation 1033
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372573029"
variation 1034
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:757022147"
variation 1035
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:749835968"
variation 1039
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1336183044"
variation 1042
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226536023"
variation 1044
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1169580922"
variation 1046
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1328355987"
variation 1049
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:763933769"
variation 1051
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:755143367"
variation 1053
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1732857252"
variation 1055
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1732856918"
variation 1058
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1732856094"
variation 1061
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:147637073"
variation 1068
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:753877466"
variation 1070
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477955709"
variation 1071
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:761010937"
variation 1079
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:146268187"
variation 1082
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:768047138"
variation 1084
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:765400231"
variation 1086
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1318545040"
variation 1089
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1318930986"
variation 1097
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1203013954"
variation 1101
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:762054943"
variation 1110
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1457231452"
variation 1117
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390011783"
variation 1119
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:769033596"
variation 1120
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:749733890"
variation 1124
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:774889678"
variation 1131
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260625356"
variation 1135
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:769242917"
variation 1137
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:745566684"
variation 1138
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:780789814"
variation 1139
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1732846605"
variation 1142
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757110109"
variation 1146
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1191524011"
variation 1150
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:746766727"
variation 1151
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712479884"
variation 1153
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1732845228"
exon 1159..1286
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1163
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:748086966"
variation 1165
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370547296"
variation 1166
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:756332026"
variation 1167
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:750522059"
variation 1168
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1422410078"
variation 1169
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1560480228"
variation 1170
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1732682792"
variation 1171
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577630270"
variation 1172
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:781366656"
variation 1173
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:757447863"
variation 1177
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1430612610"
variation 1178
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1732681064"
variation 1179
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1373483118"
variation 1180
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:751752473"
variation 1181
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:764412674"
variation 1183
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1732679666"
variation 1187
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1457923297"
variation 1197
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:942365639"
variation 1200
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1190197384"
variation 1217
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1266595074"
variation 1220
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2109336404"
variation 1236
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:763343031"
variation 1238
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1732677186"
variation 1239
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1490703306"
variation 1245
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:568456315"
variation 1256
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1330057403"
variation 1260
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368650385"
variation 1263
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1732675587"
variation 1265
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1732675304"
variation 1268
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1732674976"
variation 1271
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397586114"
variation 1274
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374397701"
variation 1283
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:759977251"
exon 1287..1364
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1289
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310873193"
variation 1290
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765859006"
variation 1295
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1405131241"
variation 1298
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1337122296"
variation 1300
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1470947104"
variation 1301
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1003973718"
variation 1302
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577623418"
variation 1303
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370395999"
variation 1306
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2109329706"
variation 1308
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:553922327"
variation 1311..1317
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aca"
/replace="acagaca"
/db_xref="dbSNP:2109329674"
variation 1311
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:767188725"
variation 1314..1316
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gac"
/db_xref="dbSNP:1290337548"
variation 1317
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1364992384"
variation 1320
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:554007339"
variation 1324
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1732370945"
variation 1325
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1369525354"
variation 1326
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:761503527"
variation 1332
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:774297193"
variation 1333..1335
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gaa"
/db_xref="dbSNP:1553908307"
variation 1333
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:201262908"
variation 1334
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:775464159"
variation 1337
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:770979712"
variation 1338
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:747097405"
variation 1341
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1732367045"
variation 1353
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463774048"
variation 1355
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1732366479"
exon 1365..1453
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1368
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308181030"
variation 1374
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:764017338"
variation 1377
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328128651"
variation 1381
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321434916"
variation 1382
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:762834723"
variation 1383
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1732257959"
variation 1385
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1732257652"
variation 1390
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1732257300"
variation 1393
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1365607689"
variation 1394
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1387446605"
variation 1397
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149132912"
variation 1400
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:769782339"
variation 1403
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1318878617"
variation 1413
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1732255290"
variation 1416
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1732254839"
variation 1418
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:745724860"
variation 1422..1427
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aag"
/replace="aagaag"
/db_xref="dbSNP:1391288799"
variation 1424
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:952748081"
variation 1430
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:749513506"
variation 1431
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2109326859"
variation 1432
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:772090924"
variation 1434
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:138169536"
variation 1438
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:890038163"
variation 1439
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150406881"
variation 1441
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1732250438"
variation 1443
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:61755862"
variation 1446
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:749654225"
variation 1447
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:780228038"
variation 1448
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437451385"
variation 1451
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1732248545"
variation 1452
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1272116556"
exon 1454..1526
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1459
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1382212580"
variation 1463
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146819304"
variation 1468
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291076014"
variation 1471
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1730198869"
variation 1472
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1403194419"
variation 1473
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:778426505"
variation 1475
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:754862468"
variation 1476
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:752587899"
variation 1477..1482
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:767604256"
variation 1479
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1386910850"
variation 1482
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422083797"
variation 1483
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1730196425"
variation 1485
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766099286"
variation 1489
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1427637520"
variation 1496
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:756079377"
variation 1499
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:750315279"
variation 1502
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1553903679"
variation 1504
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489656409"
variation 1505
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:764270875"
variation 1507
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201279692"
variation 1508
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1730193538"
variation 1509
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1248729184"
variation 1514
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:775836152"
variation 1516
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1250043941"
variation 1518..1523
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aat"
/replace="aataat"
/db_xref="dbSNP:1577580116"
variation 1518
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:765389477"
variation 1520
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1730191752"
variation 1526
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1488025627"
variation 1526
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:759871377"
exon 1527..1632
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1529
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153211442"
variation 1530
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1729617282"
variation 1533
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1729616992"
variation 1534
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1209064180"
variation 1536
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1225445391"
variation 1541
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143787103"
variation 1544
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729615695"
variation 1545
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306603922"
variation 1546
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1392148813"
variation 1550
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:752722313"
variation 1553
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1333105965"
variation 1558
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:765318678"
variation 1560
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405267703"
variation 1563
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:141373133"
variation 1565
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:776970819"
variation 1569
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:761117202"
variation 1577
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:554799362"
variation 1578
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729611985"
variation 1580
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:772460704"
variation 1581
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1253173180"
variation 1586
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729610996"
variation 1589
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729610672"
variation 1592
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729610385"
variation 1593
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:748628033"
variation 1594
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:373156864"
variation 1602
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1729609369"
variation 1604
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153211414"
variation 1605
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390324721"
variation 1606
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376344210"
variation 1608
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:777443512"
variation 1612
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1729608076"
variation 1617
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1729607770"
variation 1621
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:748975781"
variation 1625
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1041302180"
variation 1629
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1357937815"
variation 1630
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1729606462"
exon 1633..1715
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1637
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317468879"
variation 1640
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:762450655"
variation 1641
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1361854427"
variation 1651
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:774917399"
variation 1652
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291855158"
variation 1656
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:769453426"
variation 1660
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195945199"
variation 1661
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:745476163"
variation 1662
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:146629097"
variation 1663
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1474594415"
variation 1664
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1729471227"
variation 1665
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:746969175"
variation 1668
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:777753253"
variation 1671
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:537110147"
variation 1675
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153210865"
variation 1686
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1266824578"
variation 1693
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:867606765"
variation 1694
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:762348575"
variation 1695
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372291630"
variation 1696
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729468029"
variation 1698
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:752183723"
variation 1699
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:756424318"
variation 1700
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:750615658"
variation 1706
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1166088235"
variation 1707
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1729466393"
variation 1710
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1305315992"
variation 1715
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366242386"
exon 1716..1765
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1716
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:780309877"
variation 1718..1721
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1729218192"
variation 1718
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729218566"
variation 1721
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:144542894"
variation 1723
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729216932"
variation 1724
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:781459056"
variation 1726
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:148589369"
variation 1727
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439530628"
variation 1731
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1729215722"
variation 1732
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1414720650"
variation 1734
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1729214875"
variation 1736
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1284163173"
variation 1742
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1335594774"
variation 1746
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004650159"
variation 1747
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34999127"
variation 1748
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149878433"
variation 1749
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:764396756"
variation 1751
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1336060392"
variation 1752
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:758938584"
variation 1756
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1470363633"
variation 1764
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139072426"
exon 1766..1835
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1767
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:114187459"
variation 1769
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1728648357"
variation 1771
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457031497"
variation 1774
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:966678854"
variation 1778
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:747194842"
variation 1780
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:778152069"
variation 1781
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1728646926"
variation 1784
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:771536720"
variation 1786
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1728646385"
variation 1794
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1357805168"
variation 1795
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:556457468"
variation 1797
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:959080537"
variation 1799
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:753261289"
variation 1800
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:765729012"
variation 1802
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:755373545"
variation 1804
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1728644131"
variation 1807
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153207020"
variation 1808..1810
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1345824270"
variation 1808
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1728643859"
variation 1810
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201550968"
variation 1811
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:536543433"
variation 1814
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:183217125"
variation 1815
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1422947869"
variation 1816
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:147389955"
variation 1817
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153207009"
variation 1818
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1162686693"
variation 1820
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:772642028"
variation 1822
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:772966106"
variation 1823
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1728640823"
variation 1827
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:111803728"
variation 1834
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415890327"
variation 1835
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1184656480"
exon 1836..1920
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1837
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1489696054"
variation 1839
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:937405971"
variation 1842
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:755530942"
variation 1844
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153199456"
variation 1845
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1319203008"
variation 1849
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:754256637"
variation 1852
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:530492116"
variation 1854
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:755553887"
variation 1855
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368857238"
variation 1858
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1350793124"
variation 1867
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:761503447"
variation 1868
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:561646938"
variation 1872
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:967533511"
variation 1877
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488434113"
variation 1881
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1726512577"
variation 1885
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296238901"
variation 1889
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2153199448"
variation 1890
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1464849851"
variation 1893
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:981593856"
variation 1902
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:763759517"
variation 1903
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1726510969"
variation 1914
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:762990643"
variation 1915
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1726510308"
variation 1916
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1014481355"
variation 1920
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153199442"
exon 1921..2060
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 1922
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:780410287"
variation 1933..1935
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1327854815"
variation 1933
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:755748061"
variation 1940
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:749953910"
variation 1944
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:969960978"
variation 1946
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333594541"
variation 1952
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1182341022"
variation 1961
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1461262895"
variation 1962
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:780804324"
variation 1963
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:757004781"
variation 1964
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:768881260"
variation 1965
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1578099931"
variation 1971
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022846322"
variation 1974
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1726208716"
variation 1979..2000
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gcgagca"
/replace="gcgagcagtctatcagcgagca"
/db_xref="dbSNP:1726203876"
variation 1980
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1241113212"
variation 1981
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1330464217"
variation 1984
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:764002108"
variation 1985
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1726207169"
variation 1987..1992
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tc"
/replace="tctatc"
/db_xref="dbSNP:1726205449"
variation 1987..1988
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gaataaagatcaaaa"
/db_xref="dbSNP:1726206834"
variation 1988
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:762643177"
variation 1990
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:151214952"
variation 1991
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339806867"
variation 1995
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765091187"
variation 1996
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:759412754"
variation 1997
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1726204199"
variation 1998..2014
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gca"
/replace="gcatctacatctgtgca"
/db_xref="dbSNP:889228867"
variation 2000
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:370067123"
variation 2005
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1297240304"
variation 2006
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419904534"
variation 2007
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201892304"
variation 2009
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1726202155"
variation 2010
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:762060103"
variation 2011
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:774412533"
variation 2013
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2153198577"
variation 2014
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1026723682"
variation 2015
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:769119067"
variation 2018
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:956862653"
variation 2019
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1726199614"
variation 2021
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:749609027"
variation 2022
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1726198927"
variation 2023
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1726198617"
variation 2024
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:775854176"
variation 2027
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1726197894"
variation 2031
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1578099694"
variation 2033
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770450885"
variation 2034
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1217699790"
variation 2036
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489389581"
variation 2039
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1185633919"
variation 2042
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1578099643"
variation 2045
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:531849775"
variation 2047
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1726195158"
variation 2048
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:140537942"
variation 2049
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1355314248"
variation 2051
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:147215077"
variation 2052
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1246860495"
variation 2055
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:746735074"
variation 2058
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199644717"
exon 2061..2199
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2069
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1171942397"
variation 2072
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:141769822"
variation 2075
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427252478"
variation 2077
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1172262363"
variation 2079
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:778720044"
variation 2080
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:368090353"
variation 2089
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:761428354"
variation 2093
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139938498"
variation 2098
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724444941"
variation 2099
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:766296258"
variation 2104..2105
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1724444232"
variation 2105
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:917807439"
variation 2107
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:143631171"
variation 2108
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1199162106"
variation 2109
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1431038169"
variation 2110
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:751599908"
variation 2112
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1319451357"
variation 2113
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1275885406"
variation 2114
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1218350838"
variation 2115
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1724440987"
variation 2121
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724440621"
variation 2124
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724440274"
variation 2125
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1345290995"
variation 2126
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1276191587"
variation 2128
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1578070541"
variation 2131
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:3792687"
variation 2132
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201201463"
variation 2133
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1332672729"
variation 2135
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:775835064"
variation 2137
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:563285062"
variation 2141
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724436633"
variation 2142
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:759976081"
variation 2152
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:920038321"
variation 2159
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1415055978"
variation 2161
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1724435171"
variation 2162
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427556593"
variation 2165
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149361269"
variation 2167
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1261629677"
variation 2169
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:771579188"
variation 2171
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1269803445"
variation 2173
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216466198"
variation 2174
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:199797696"
variation 2178
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1724432236"
variation 2179..2180
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1724431606"
variation 2179
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:761195916"
variation 2183
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1724431298"
variation 2190
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724430979"
variation 2196
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1459032502"
variation 2197
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1288524729"
variation 2198
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:772627948"
variation 2199
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724429542"
exon 2200..2264
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2204
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:202148347"
variation 2208
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381510091"
variation 2212
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:907086262"
variation 2214
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1724055862"
variation 2219..2227
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gaagaa"
/replace="gaagaagaa"
/db_xref="dbSNP:1560397719"
variation 2219
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1338456866"
variation 2221
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1445376358"
variation 2224
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276382695"
variation 2225
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:779852825"
variation 2227
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1036369116"
variation 2228
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1560397700"
variation 2229
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724052771"
variation 2232
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1300216792"
variation 2233
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:916193797"
variation 2234..2236
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aat"
/replace="aataat"
/db_xref="dbSNP:1724051429"
variation 2235
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:769611670"
variation 2240
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1724051111"
variation 2244
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1724050727"
variation 2245
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:745855609"
variation 2247
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:556475227"
variation 2254
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1405867606"
variation 2255
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415413257"
exon 2265..2437
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2265
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:762246314"
variation 2266
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:902437426"
variation 2269
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1722124805"
variation 2273
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1292724630"
variation 2274
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1722124453"
variation 2278..2282
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ctc"
/replace="ctctc"
/db_xref="dbSNP:752430276"
variation 2282
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:374708577"
variation 2286
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:773871555"
variation 2287
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:145068951"
variation 2290
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464684851"
variation 2291
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1423697094"
variation 2292
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:775197702"
variation 2293
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:769547505"
variation 2295
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:745684249"
variation 2298
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141340925"
variation 2299
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1722120189"
variation 2301
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1722119872"
variation 2303
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481228060"
variation 2305
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489645188"
variation 2308
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1236914733"
variation 2312
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:770922930"
variation 2313
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:949278437"
variation 2314
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:574809709"
variation 2316
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370223580"
variation 2317
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146595907"
variation 2318
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153189230"
variation 2319
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:368840018"
variation 2320
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:780318887"
variation 2321
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1219608741"
variation 2322
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560378179"
variation 2323
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:547526738"
variation 2324..2349
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="gaatgattttgctcttataattgatg"
/db_xref="dbSNP:754744818"
variation 2324
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329287321"
variation 2328
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1211348375"
variation 2334
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1285028831"
variation 2335
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1445940211"
variation 2337
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="cc"
/db_xref="dbSNP:781101673"
variation 2341
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1478425775"
variation 2342
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1299393276"
variation 2349
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1722112458"
variation 2350
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1722112183"
variation 2351
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1376743645"
variation 2354
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1722111436"
variation 2356
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176289518"
variation 2360
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1242240287"
variation 2366
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:756222876"
variation 2368
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1560378060"
variation 2369
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477419322"
variation 2373
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1188905779"
variation 2374
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:750809374"
variation 2379
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1178625493"
variation 2380
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1722108347"
variation 2382
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150461575"
variation 2383
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:757790458"
variation 2385
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1198813685"
variation 2386
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752026708"
variation 2390
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1722106296"
variation 2392
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1722105848"
variation 2395
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1722105307"
variation 2396
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256853722"
variation 2399
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:763654428"
variation 2402
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1722104338"
variation 2407
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349860385"
variation 2408
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:931404347"
variation 2414
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239080437"
variation 2416
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:762450673"
variation 2418
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1722102508"
variation 2419
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1578029058"
variation 2421
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1309002478"
variation 2424
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:920001708"
variation 2426
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:771795923"
variation 2427
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:774799725"
variation 2428..2430
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1346257072"
variation 2432
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:764956503"
variation 2436
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:867059514"
variation 2437
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374740812"
exon 2438..2621
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2438
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1577985669"
variation 2443..2448
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ctc"
/replace="ctcctc"
/db_xref="dbSNP:1394050010"
variation 2444
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1262711781"
variation 2455
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:2153183098"
variation 2463
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719588693"
variation 2466
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:746034954"
variation 2469
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:868211066"
variation 2472
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719587735"
variation 2483
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719587361"
variation 2484
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1420726054"
variation 2488
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1387555335"
variation 2489
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:781647686"
variation 2490..2492
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:766729251"
variation 2490
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:757608421"
variation 2491
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:752128867"
variation 2493
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:778262095"
variation 2494
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1719584683"
variation 2495
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:758848815"
variation 2496
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:375992978"
variation 2500
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000575278"
variation 2501
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:201046724"
variation 2504
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1478012067"
variation 2507
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1175483888"
variation 2508
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426712920"
variation 2510
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1169331732"
variation 2511
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:753411468"
variation 2514
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1719580497"
variation 2515
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1560354254"
variation 2517
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1208058663"
variation 2518
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153183068"
variation 2522
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1383618191"
variation 2524
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153183064"
variation 2525
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1380089122"
variation 2529
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1316824039"
variation 2532
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:766333923"
variation 2543
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719577357"
variation 2546
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:946356763"
variation 2548
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:770233505"
variation 2549
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:760540371"
variation 2552
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1234616194"
variation 2553
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:560081854"
variation 2554
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1044887319"
variation 2561
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:541467744"
variation 2564
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:772147792"
variation 2567
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1719573885"
variation 2568
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719573475"
variation 2569
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719572953"
variation 2574
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:761603135"
variation 2582
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:775666433"
variation 2584
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1719571590"
variation 2585
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:769729360"
variation 2587
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719570943"
variation 2588
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199910712"
variation 2589
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1321597186"
variation 2590
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1719569748"
variation 2591
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1167685884"
variation 2592
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1235702284"
variation 2593
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:763103232"
variation 2594
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1553879352"
variation 2599
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:267600160"
variation 2601
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:917862727"
variation 2606
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:781391987"
variation 2607
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771077158"
variation 2609
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1476508857"
variation 2612
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1664452066"
variation 2613
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560354014"
variation 2614
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1719565583"
variation 2616
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:747391160"
exon 2622..2732
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2626
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201823579"
variation 2627
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:771168859"
variation 2630
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302851257"
variation 2638
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:558818966"
variation 2641
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153182994"
variation 2643
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1719551355"
variation 2648
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719551042"
variation 2649..2650
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="at"
/db_xref="dbSNP:765831625"
variation 2654
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1577984825"
variation 2657
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:539086429"
variation 2659
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:376699635"
variation 2660
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:964143037"
variation 2663
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1719548709"
variation 2665
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1719548339"
variation 2667
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153182983"
variation 2669
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:748750232"
variation 2671
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276118505"
variation 2672
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199509246"
variation 2674
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1346229394"
variation 2685
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:779281307"
variation 2686
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153182978"
variation 2687
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238339580"
variation 2688
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:755444266"
variation 2693
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:748819525"
variation 2702
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1719545416"
variation 2708
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1719544948"
variation 2712
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:779661422"
variation 2713
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1354246756"
variation 2728
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1357469732"
variation 2729
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:755858752"
exon 2733..2807
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2735
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1419717503"
variation 2737
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1718394981"
variation 2744
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1398091569"
variation 2747
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1188681491"
variation 2752
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1279809748"
variation 2755
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1718393754"
variation 2763
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:745572336"
variation 2765
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1718393084"
variation 2766
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1246677550"
variation 2771
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1214837127"
variation 2781
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1469921579"
variation 2788
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:115298940"
variation 2790
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:756879508"
variation 2793
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:751337554"
variation 2795
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:763914267"
variation 2800
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1718389783"
variation 2804
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:61735691"
variation 2805
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:1302644386"
variation 2805
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:151327910"
exon 2808..2930
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2808
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1190958795"
variation 2825
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:764420896"
variation 2831
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:775941358"
variation 2834
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238222975"
variation 2836
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:770449166"
variation 2838
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308519985"
variation 2839
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265739329"
variation 2841
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1393728859"
variation 2849
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560342938"
variation 2851
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1354456582"
variation 2853
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1718366416"
variation 2855
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1718366082"
variation 2856
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1455712983"
variation 2865
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1718365379"
variation 2869..2873
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="acatg"
/db_xref="dbSNP:748061806"
variation 2874
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1718364740"
variation 2876
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1417057680"
variation 2879
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:760084218"
variation 2881
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:776049107"
variation 2886
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1194505939"
variation 2890..2893
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tata"
/replace="tatatata"
/db_xref="dbSNP:1454760578"
variation 2890
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1718363025"
variation 2895
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1365990411"
variation 2896
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:74414963"
variation 2897
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1161457295"
variation 2902
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1474898118"
variation 2906
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:746699239"
variation 2910
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:950046694"
variation 2911
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771647511"
variation 2913
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1718358988"
variation 2914
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372216957"
variation 2924
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1718358301"
variation 2925
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1718357971"
variation 2926
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1560342811"
variation 2928
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:199975147"
exon 2931..3009
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 2933
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263762200"
variation 2935
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1717987047"
variation 2944
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:753146965"
variation 2948
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:765670060"
variation 2950
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1013995427"
variation 2952
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:760015294"
variation 2953
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1717985156"
variation 2954
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370755030"
variation 2956
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1251078097"
variation 2957..2958
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1717983524"
variation 2957
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1717983964"
variation 2960
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1717983182"
variation 2964
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1207967961"
variation 2965
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:190084279"
variation 2978
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:375960450"
variation 2981
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201094493"
variation 2984
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2153178127"
variation 2988
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153178126"
variation 2990
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1315696403"
variation 2997
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1422917319"
variation 2998
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:889028794"
variation 3005
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452299333"
variation 3009
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:771733177"
exon 3010..3071
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 3010
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1717288137"
variation 3011
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1171542734"
variation 3013
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018178667"
variation 3014
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1717287141"
variation 3017
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:139505439"
variation 3018
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1433815110"
variation 3020
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768401911"
variation 3022
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1195400249"
variation 3025
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1717285183"
variation 3029
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:749111379"
variation 3034
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1231809129"
variation 3036
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1717284143"
variation 3037..3038
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="cg"
/db_xref="dbSNP:2153175713"
variation 3037
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:775087828"
variation 3038
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:745763505"
variation 3039
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1254895223"
variation 3050
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1274983971"
variation 3053
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:373123815"
variation 3054
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210650408"
variation 3055
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:868810722"
variation 3058
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487529479"
variation 3060..3062
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1717280592"
variation 3062
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1717280265"
variation 3063
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1717279921"
variation 3065
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1468720062"
variation 3067
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1345545799"
variation 3068
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349006335"
variation 3069
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:778049118"
variation 3070
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:758539532"
variation 3071
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1717277663"
exon 3072..3128
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 3078
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216206169"
variation 3079
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1227158373"
variation 3086
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1717013389"
variation 3089
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:147792614"
variation 3095
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:200581251"
variation 3098
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:781666426"
variation 3107
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:144342471"
variation 3113
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:757702547"
variation 3115
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:865784125"
variation 3116
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:755055422"
variation 3127
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1277383709"
exon 3129..3236
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 3134
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:773007378"
variation 3137
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302537700"
variation 3142
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1055141971"
variation 3143
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1369073845"
variation 3146
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1445514736"
variation 3147
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1716882284"
variation 3149
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:764297544"
variation 3153
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1716881653"
variation 3155
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1461175659"
variation 3158
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:762946178"
variation 3159
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:754952867"
variation 3167
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1433203002"
variation 3168
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1395050935"
variation 3172
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1433985778"
variation 3174..3179
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:2153174664"
variation 3174
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1294677892"
variation 3175
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1716878398"
variation 3182
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1174785868"
variation 3183
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:770024010"
variation 3187
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216781968"
variation 3189
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:746048297"
variation 3191
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:931278936"
variation 3193
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:777031347"
variation 3196
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1716875851"
variation 3198
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1285518147"
variation 3200
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1577941785"
variation 3201
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1234772922"
variation 3205
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:771273391"
variation 3206
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1716874158"
variation 3207
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333927143"
variation 3210
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:868693295"
variation 3211
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140420171"
variation 3212
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:778148153"
variation 3213
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1234916577"
variation 3214
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:758886673"
variation 3215
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:572199208"
variation 3218
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:564983245"
variation 3219
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153174644"
variation 3222
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:199599944"
variation 3223
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1309433410"
variation 3226
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374633134"
variation 3227
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1375205116"
variation 3231
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461897954"
variation 3233
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577941575"
variation 3236
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:766331746"
exon 3237..3325
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 3237
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1461482569"
variation 3240
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153168157"
variation 3243
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:754520471"
variation 3245
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:749011547"
variation 3250
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:779853519"
variation 3253
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425303424"
variation 3257
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1259629147"
variation 3259
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1714258681"
variation 3260
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204463665"
variation 3263
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:202090520"
variation 3266
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:750206508"
variation 3272
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1166268429"
variation 3273
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1211216952"
variation 3275
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:762125576"
variation 3276
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153168145"
variation 3277
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:767301299"
variation 3278
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1316689782"
variation 3281
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:757180900"
variation 3282
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:751502747"
variation 3287
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042282595"
variation 3288
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:765368933"
variation 3290
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200613613"
variation 3294
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:200291526"
variation 3295
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:753857860"
variation 3296
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1714252213"
variation 3301
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1397687838"
variation 3302
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:913590426"
variation 3305
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1395542379"
variation 3306
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1714250541"
variation 3309
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1311293090"
variation 3311
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1357377816"
variation 3312
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:766613625"
variation 3313
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1459298855"
variation 3314
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:760914967"
variation 3315
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:773492388"
variation 3317
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:374530990"
variation 3319
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:774990376"
variation 3320
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191244573"
variation 3321
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2153168129"
variation 3322
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:769215914"
variation 3324
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:748819585"
exon 3326..3418
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 3327
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:745575593"
variation 3328
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147185371"
variation 3330..3331
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1303066898"
variation 3331..3334
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1411613619"
variation 3331
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1714150134"
variation 3347
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:780903769"
variation 3351
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1560307032"
variation 3352
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:770433571"
variation 3353
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:746829624"
variation 3356
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:777508784"
variation 3357
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1468128450"
variation 3360
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:561560464"
variation 3363
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:758376440"
variation 3367
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1182434394"
variation 3368
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:752611140"
variation 3372
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:780058864"
variation 3374
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:756211915"
variation 3377
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153167895"
variation 3380..3383
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1714142748"
variation 3382
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:750400512"
variation 3386
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:934119723"
variation 3387
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1281301304"
variation 3388
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:767789884"
variation 3391
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1714140938"
variation 3392
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:757504455"
variation 3397
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1714140166"
variation 3398
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:893332732"
variation 3399
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153167890"
variation 3400
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1032489541"
variation 3402
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1577900877"
variation 3404
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286234238"
variation 3410
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:754623658"
variation 3417
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1714137687"
variation 3418
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1714137287"
exon 3419..3510
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 3422
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1713027827"
variation 3425
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458320550"
variation 3426
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1391889133"
variation 3432
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:757592959"
variation 3434
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:376686282"
variation 3437
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:758839266"
variation 3440
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:752949195"
variation 3446
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:765795614"
variation 3449
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:759921525"
variation 3450
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:373678420"
variation 3457
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1713023258"
variation 3461
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:765857627"
variation 3465
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:760381619"
variation 3467
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200623522"
variation 3468
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369168664"
variation 3470
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:961248505"
variation 3473
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291779246"
variation 3474
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1212537397"
variation 3477..3480
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="tacc"
/db_xref="dbSNP:1713019130"
variation 3479
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1713019622"
variation 3480
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:778412248"
variation 3481
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:569311998"
variation 3482
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1354391900"
variation 3483
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231142462"
variation 3484
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1560298632"
variation 3487
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:768669151"
variation 3492
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:765846021"
variation 3496
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1713016034"
variation 3497
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292654304"
variation 3501
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1374347595"
variation 3503
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153165553"
variation 3504
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:376142691"
variation 3506
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:549689467"
variation 3508
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1713013804"
variation 3509
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1203210990"
variation 3510
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:747020538"
exon 3511..8151
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/inference="alignment:Splign:2.1.0"
variation 3511
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1410482102"
variation 3515
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434948851"
variation 3517
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712798748"
variation 3521
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:146513232"
variation 3524
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:112287290"
variation 3542
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1472181385"
variation 3545
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:748299606"
variation 3546
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:779394605"
variation 3552
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:111511494"
variation 3557
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153165067"
variation 3558
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:866754505"
variation 3560
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560296925"
variation 3563
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:962310783"
variation 3564
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487247759"
variation 3568
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712793036"
variation 3569
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1484665387"
variation 3576
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:975581993"
variation 3578
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:755297803"
variation 3579
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:754168075"
variation 3583
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:780548514"
variation 3584
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:756560495"
variation 3588
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1350660588"
variation 3591
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1290621160"
variation 3593
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413279361"
variation 3595
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1253502718"
variation 3596
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:78469447"
variation 3597
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:111660456"
variation 3599
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372305715"
variation 3600
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:751157914"
variation 3603
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1003865284"
variation 3605
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1158435348"
variation 3607
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1021518507"
variation 3608
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712784271"
variation 3610..3613
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:35124512"
variation 3610
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:764016470"
variation 3611
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490985453"
variation 3616
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:955051463"
variation 3617
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368892235"
variation 3619
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153165041"
variation 3624
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284253662"
variation 3626
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712780920"
variation 3627
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184121797"
variation 3629
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1474087457"
variation 3633
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:375445242"
variation 3634..3636
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:761083373"
variation 3643
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1484154591"
variation 3644
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:775377029"
variation 3648
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712778538"
variation 3650
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1207492516"
variation 3651
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712777887"
variation 3652
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712777523"
variation 3663
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1188480636"
variation 3666
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712776828"
variation 3669
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1486546427"
variation 3670
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:144171824"
variation 3671
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:548843158"
variation 3675
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712775120"
variation 3677
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:535531467"
variation 3680
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1450331077"
variation 3683
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712774162"
variation 3685
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1209769826"
variation 3687
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1284656502"
variation 3689..3690
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ca"
/db_xref="dbSNP:1364429256"
variation 3690
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1029716222"
variation 3692
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712772464"
variation 3693
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1225867629"
variation 3699
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1276598229"
variation 3700
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:183887626"
variation 3702
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712771016"
variation 3705
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1199472515"
variation 3708
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:866387092"
variation 3713
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276075271"
variation 3715
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1712769329"
variation 3715
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:764496231"
variation 3721
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:1712768654"
variation 3722
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712768305"
variation 3725
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712767970"
variation 3731
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:996620177"
variation 3732
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1055846896"
variation 3735
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712766823"
variation 3736
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153165010"
variation 3737
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187668224"
variation 3738
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712765972"
variation 3740
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712765602"
variation 3752
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1003375074"
variation 3754
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1449460813"
variation 3757
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187052008"
variation 3759..3760
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1236236452"
variation 3761..3767
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="atagaca"
/db_xref="dbSNP:1172170827"
variation 3761
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1430807807"
variation 3766
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712763305"
variation 3770
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712762034"
variation 3771
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400359981"
variation 3781
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577880179"
variation 3783
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1315750816"
variation 3784
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:907327025"
variation 3786
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712760184"
variation 3788
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1036358087"
variation 3789
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1357785694"
variation 3791..3806
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="aacaccatctcttttg"
/db_xref="dbSNP:1712756729"
variation 3791
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1560296516"
variation 3797
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1311421378"
variation 3798
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414440478"
variation 3799
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1385943994"
variation 3800
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1365573947"
variation 3802..3805
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1712757115"
variation 3807
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164995"
variation 3808
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712756364"
variation 3809..3815
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttttt"
/replace="ttttttt"
/replace="tttttttt"
/db_xref="dbSNP:940702836"
variation 3815
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1232303188"
variation 3816
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712755048"
variation 3818
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712754652"
variation 3824
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712754304"
variation 3828..3829
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="aa"
/db_xref="dbSNP:570964598"
variation 3831
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1267003260"
variation 3836
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049359620"
variation 3838
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1363256898"
variation 3841
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:564805783"
variation 3842
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1429432113"
variation 3843
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712749489"
variation 3848
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1198654060"
variation 3849
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1577880001"
variation 3852
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1560296406"
variation 3856
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164981"
variation 3857
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:899544949"
variation 3858
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712747718"
variation 3864
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054297142"
variation 3870
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712747006"
variation 3873
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1415444737"
variation 3879
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712746300"
variation 3881
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1712745896"
variation 3887
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1186952489"
variation 3888
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:922102013"
variation 3891
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1447278547"
variation 3893
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712744249"
variation 3901
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000027031"
variation 3906
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577879918"
variation 3910
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="t"
/db_xref="dbSNP:1712743251"
variation 3912
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712742890"
variation 3914
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:773658839"
variation 3918
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1389319746"
variation 3921
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712741755"
variation 3922
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:546801166"
variation 3925
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:965493561"
variation 3934
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1332449789"
variation 3942
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164970"
variation 3949
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1041643596"
variation 3951
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577879861"
variation 3954
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1577879853"
variation 3956
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712739071"
variation 3958
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1485278032"
variation 3964
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1577879838"
variation 3966
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:950054292"
variation 3968
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1229715752"
variation 3973
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712737169"
variation 3977
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712736831"
variation 3981
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1270548197"
variation 3982..3985
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:977036790"
variation 3985
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:373856685"
variation 3988
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712735363"
variation 3990
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265785231"
variation 3991
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712734517"
variation 3997
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1214916998"
variation 3998
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:967033245"
variation 4007
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:895829612"
variation 4010
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1411546548"
variation 4014
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712732771"
variation 4016
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712732398"
variation 4018
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021466124"
variation 4034
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:533132893"
variation 4035
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:763586212"
variation 4043
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712730880"
variation 4048
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457396556"
variation 4051
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712730183"
variation 4052
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2153164943"
variation 4054
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1161404206"
variation 4059
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153164941"
variation 4061
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1392530310"
variation 4063
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712729153"
variation 4066..4067
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1577879697"
variation 4068
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1405362531"
variation 4072
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712728065"
variation 4077
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:920674579"
variation 4083
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1233048071"
variation 4084
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712727289"
variation 4085
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:564375896"
variation 4086
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712726550"
variation 4089
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712726237"
variation 4091
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1411090780"
variation 4094
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712725557"
variation 4104
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712725218"
variation 4108
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:907274577"
variation 4112
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138767953"
variation 4115..4149
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aaattgtcttgataaatgtttgccaaagaggttca"
/db_xref="dbSNP:765250272"
variation 4115
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712724132"
variation 4117
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:775053608"
variation 4120
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:546499061"
variation 4121
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712722717"
variation 4123
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712722360"
variation 4124
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712721988"
variation 4125
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004863710"
variation 4127
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:887791142"
variation 4129
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1049281720"
variation 4130
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712720404"
variation 4136
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:932223318"
variation 4139
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:940851288"
variation 4141
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712719186"
variation 4147
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:550812815"
variation 4149
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:922241644"
variation 4154
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1162548782"
variation 4164
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1384408157"
variation 4169
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712716635"
variation 4170
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1326623200"
variation 4175
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1370143171"
variation 4176
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425035243"
variation 4183
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712715059"
variation 4189
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712714675"
variation 4193
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2153164911"
variation 4195
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1167769724"
variation 4200
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712714037"
variation 4202
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:908160126"
variation 4212
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1463008924"
variation 4215
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:987703528"
variation 4216
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:955098722"
variation 4218
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1431309180"
variation 4219
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:530852177"
variation 4224
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1298410744"
variation 4225
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712710145"
variation 4226
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1377730742"
variation 4230
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712709459"
variation 4234
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148482061"
variation 4236
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1311146231"
variation 4237
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1342837538"
variation 4241
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712707947"
variation 4243
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577879405"
variation 4245
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:944898106"
variation 4247
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274457209"
variation 4248
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712706691"
variation 4250
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:975444822"
variation 4251
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712706046"
variation 4263
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712705701"
variation 4264
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:745407531"
variation 4266
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:541987714"
variation 4268
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:28577194"
variation 4269
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1180238860"
variation 4271
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:191664533"
variation 4273
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:144524974"
variation 4274..4276
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1427536182"
variation 4280
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712702198"
variation 4282
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1014188766"
variation 4284
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1187679683"
variation 4298
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:895683648"
variation 4299
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1170661899"
variation 4306
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:914239323"
variation 4307
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577879242"
variation 4310
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1470267855"
variation 4312
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:989874752"
variation 4316
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712698687"
variation 4322
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712698336"
variation 4323
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1712698002"
variation 4327
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1271847412"
variation 4337..4344
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttgt"
/replace="ttgtttgt"
/db_xref="dbSNP:530977129"
variation 4339
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712697256"
variation 4341
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1304120916"
variation 4343
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164872"
variation 4345
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454039351"
variation 4346
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:771152492"
variation 4354
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363419412"
variation 4356
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712695034"
variation 4359
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216710530"
variation 4360
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1253420651"
variation 4362
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:937333200"
variation 4363
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:777626677"
variation 4364
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1003102533"
variation 4368
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712690544"
variation 4369
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:149722558"
variation 4370
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1037734733"
variation 4372
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164864"
variation 4379
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712689283"
variation 4381
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:940757965"
variation 4382..4385
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1304330837"
variation 4382
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577879108"
variation 4385..4391
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tgtt"
/replace="tgttgtt"
/db_xref="dbSNP:1186940119"
variation 4385..4387
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1004979622"
variation 4386
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451050352"
variation 4388
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:908061725"
variation 4392
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1712686369"
variation 4393
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712685896"
variation 4400
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712685562"
variation 4401
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712685225"
variation 4410
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1560295755"
variation 4412..4420
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tatgt"
/replace="tatgtatgt"
/db_xref="dbSNP:1577879024"
variation 4413
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423991951"
variation 4414..4416
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1443214365"
variation 4414
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:887738362"
variation 4415
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1177588365"
variation 4417
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712682965"
variation 4424
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164849"
variation 4426
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712682292"
variation 4433
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368793447"
variation 4436
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712681500"
variation 4448
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1325176063"
variation 4449..4453
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tcatt"
/db_xref="dbSNP:1712680723"
variation 4453
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:987563658"
variation 4457
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1410416833"
variation 4458
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:576974148"
variation 4463
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1433283554"
variation 4469
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712678839"
variation 4474..4481
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gc"
/replace="gctaatgc"
/db_xref="dbSNP:1165911195"
variation 4482
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164842"
variation 4484
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1461233375"
variation 4486
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712677715"
variation 4487
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1217627621"
variation 4490
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:996220504"
variation 4493
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1577878923"
variation 4494
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1324326740"
variation 4495
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712675904"
variation 4496
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712675516"
variation 4497
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1227892437"
variation 4501
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712674848"
variation 4504
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712674512"
variation 4507
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1410849825"
variation 4510
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266147161"
variation 4514..4518
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1466231184"
variation 4518
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712673177"
variation 4519
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:900732544"
variation 4522
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:186812612"
variation 4531
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:922173779"
variation 4532..4535
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="at"
/replace="atat"
/db_xref="dbSNP:1487391407"
variation 4532
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712671637"
variation 4540
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139499505"
variation 4541
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:575196447"
variation 4548
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:147173731"
variation 4549
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1032784878"
variation 4550
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712669057"
variation 4551
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712668744"
variation 4554
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1194435569"
variation 4555
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712667938"
variation 4562
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712667605"
variation 4569
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1160483461"
variation 4576
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349589609"
variation 4577
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:535230702"
variation 4579
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1281325228"
variation 4587
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1236711395"
variation 4588
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1346447017"
variation 4589
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712664219"
variation 4592
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1409255236"
variation 4598
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1286604292"
variation 4602
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1345856024"
variation 4606
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712662469"
variation 4607
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:945800126"
variation 4608
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1274299136"
variation 4614
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1442897610"
variation 4619
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712660890"
variation 4621
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1319647701"
variation 4627
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1224508774"
variation 4630..4634
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cccac"
/replace="cccacccac"
/db_xref="dbSNP:1712659027"
variation 4631
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:914364026"
variation 4632
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337447119"
variation 4645..4649
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1577878649"
variation 4645
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1326680894"
variation 4649
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1253270657"
variation 4651..4652
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1712656955"
variation 4651
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712657303"
variation 4653
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:990211525"
variation 4655..4660
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gtagca"
/db_xref="dbSNP:1712655162"
variation 4656
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712655920"
variation 4656
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1712656251"
variation 4657
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:937048336"
variation 4662
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712654833"
variation 4663
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:978525955"
variation 4664
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:967085227"
variation 4673
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:927180485"
variation 4674
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1429416280"
variation 4675
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1432448945"
variation 4679
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:562043265"
variation 4680
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1014501763"
variation 4681
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712651792"
variation 4682
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712651432"
variation 4684
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443048554"
variation 4687
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="t"
/db_xref="dbSNP:1712650781"
variation 4687
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712650479"
variation 4688
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1158630845"
variation 4698
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:895768770"
variation 4706
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712649398"
variation 4707
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712649059"
variation 4713
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247893912"
variation 4714
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164787"
variation 4715
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712648112"
variation 4719
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712647770"
variation 4725
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:2153164783"
variation 4725
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1470838155"
variation 4727
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292299122"
variation 4731
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368757244"
variation 4733
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:765199128"
variation 4734
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:899191991"
variation 4738
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712645091"
variation 4740
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1577878467"
variation 4743
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712644088"
variation 4744
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1037639974"
variation 4746
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1014769106"
variation 4749
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1208880743"
variation 4753
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712641174"
variation 4754
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1237384860"
variation 4756
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1443402318"
variation 4763
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712639396"
variation 4766
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712639019"
variation 4769
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1004927952"
variation 4771
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:543454440"
variation 4772
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1258606311"
variation 4773
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712637430"
variation 4774
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712637076"
variation 4775
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:1213338550"
variation 4777
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1484800099"
variation 4778
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:532269565"
variation 4779
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:983317115"
variation 4780
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:952096663"
variation 4784..4787
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:34850463"
variation 4789..4791
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1712633372"
variation 4792..4797
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:1712632464"
variation 4796
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333668015"
variation 4797
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:16854343"
variation 4800
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454450346"
variation 4801
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:754887760"
variation 4802
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164757"
variation 4812
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:900511440"
variation 4813
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:73235558"
variation 4815
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:562945755"
variation 4816
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339712223"
variation 4817
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1355900205"
variation 4821
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712628421"
variation 4822
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1462278350"
variation 4824
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712627411"
variation 4827
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206053073"
variation 4829
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153164750"
variation 4831
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1009104320"
variation 4832
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:182431909"
variation 4833
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712625337"
variation 4835
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:561976672"
variation 4837..4842
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="acacgt"
/db_xref="dbSNP:1318496405"
variation 4839..4840
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gtgt"
/db_xref="dbSNP:1712624226"
variation 4840
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1412608936"
variation 4841
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:946917331"
variation 4842..4849
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttcatcat"
/replace="ttcatcattcatcat"
/db_xref="dbSNP:1712621072"
variation 4842
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1577878187"
variation 4844
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712621817"
variation 4848
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:542981073"
variation 4850
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153164739"
variation 4854
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:936914036"
variation 4855
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712620290"
variation 4857
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1337254217"
variation 4866
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:892860924"
variation 4867
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712618287"
variation 4874
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1401952083"
variation 4877
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1320123790"
variation 4878
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:548582554"
variation 4886
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712616639"
variation 4887
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712616310"
variation 4891
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712615979"
variation 4893
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1232003739"
variation 4911
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1054231566"
variation 4912
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:925621957"
variation 4914
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712614608"
variation 4915
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1405102932"
variation 4918
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1325022999"
variation 4919
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153164727"
variation 4921
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1223645127"
variation 4924
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712613191"
variation 4929
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:936974646"
variation 4930
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1329148080"
variation 4934
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:978385169"
variation 4938
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712611853"
variation 4940
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1264226554"
variation 4942
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712611167"
variation 4947
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1447940113"
variation 4950..4951
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="tg"
/db_xref="dbSNP:1198373552"
variation 4951
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157372519"
variation 4953
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:926988206"
variation 4954
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1481448120"
variation 4955
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712608893"
variation 4956
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1177299572"
variation 4957
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712608247"
variation 4958
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712607929"
variation 4960
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712607586"
variation 4961..4963
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1411146886"
variation 4963
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712606829"
variation 4969
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:779019821"
variation 4973
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712606087"
variation 4974
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712605745"
variation 4976
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1451622532"
variation 4978
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1160240620"
variation 4981
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712604729"
variation 4982
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385318931"
variation 4985
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419091325"
variation 4987
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712603710"
variation 4989
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:190010043"
variation 4990
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1386040559"
variation 4997
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:981317048"
variation 5002
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164706"
variation 5004
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712602214"
variation 5007
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712601853"
variation 5008
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:967160104"
variation 5011
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712601182"
variation 5014
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712600846"
variation 5015..5021
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/db_xref="dbSNP:1712599360"
variation 5015
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1347050374"
variation 5016
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:912978876"
variation 5019
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712599748"
variation 5023
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:559421014"
variation 5025
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712598688"
variation 5030
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1216692882"
variation 5039
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:992704848"
variation 5041
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712597561"
variation 5045
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:907820286"
variation 5046
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:960127394"
variation 5049
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712596582"
variation 5051
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1034165905"
variation 5053
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282209742"
variation 5062
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263045705"
variation 5062
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1208086548"
variation 5064
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:531550355"
variation 5065
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712594350"
variation 5077
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712594003"
variation 5078
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:963229219"
variation 5081
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1016218771"
variation 5084
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:760959717"
variation 5086
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1209668134"
variation 5093..5095
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1294975182"
variation 5095
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1289825957"
variation 5098
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712591673"
variation 5100..5101
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1712590964"
variation 5100
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712591316"
variation 5101
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712590627"
variation 5104
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:951930590"
variation 5106
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1712589860"
variation 5108
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712589549"
variation 5111
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712589225"
variation 5116
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1251104311"
variation 5118
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1417407815"
variation 5119
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004836026"
variation 5122
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712587961"
variation 5125
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712587602"
variation 5126..5128
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1457189192"
variation 5126
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712587269"
variation 5128
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:974861007"
variation 5134
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712586135"
variation 5136..5142
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaa"
/replace="aaaaa"
/replace="aaaaaa"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/db_xref="dbSNP:rs965029711"
variation 5136
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1161513228"
variation 5142
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1367036795"
variation 5144
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712583954"
variation 5148
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712583589"
variation 5150
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:886558240"
variation 5160
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712582758"
variation 5163
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052267844"
variation 5164
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:577062389"
variation 5168..5175
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttt"
/db_xref="dbSNP:966922756"
variation 5170
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712581777"
variation 5175
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577877676"
variation 5181
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1336914780"
variation 5181
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1432410233"
variation 5182
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:900686580"
variation 5183
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:893988447"
variation 5185
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1362064223"
variation 5186
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712578842"
variation 5187..5190
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tcga"
/replace="tcgatctgttaaattctcgatcga"
/db_xref="dbSNP:1712577692"
variation 5188
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1223418852"
variation 5189
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039173824"
variation 5191
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712577330"
variation 5194
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1479671605"
variation 5196
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197680844"
variation 5197
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054580842"
variation 5198
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:563902073"
variation 5203..5206
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ca"
/replace="caca"
/db_xref="dbSNP:1445045601"
variation 5203
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:925523706"
variation 5204
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712575299"
variation 5206
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:558450448"
variation 5209
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712574285"
variation 5212
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1167642060"
variation 5214
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712573583"
variation 5221
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:185598471"
variation 5222
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1045412180"
variation 5228
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712572407"
variation 5231
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712572069"
variation 5232
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:945682893"
variation 5238..5241
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1712571365"
variation 5243
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712571033"
variation 5245
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712570694"
variation 5247
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397825153"
variation 5250
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:768245638"
variation 5256
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1577877495"
variation 5268
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1452480393"
variation 5269
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:2153164662"
variation 5270
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712568890"
variation 5276
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:748815395"
variation 5278
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712567970"
variation 5282
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1240492815"
variation 5287
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712567281"
variation 5294
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:959790513"
variation 5295
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385387273"
variation 5296
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712566263"
variation 5298
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712565912"
variation 5301
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712565588"
variation 5304
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712565242"
variation 5311
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560294614"
variation 5315
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712564579"
variation 5317..5318
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1297115501"
variation 5318..5321
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1188004227"
variation 5319
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247202722"
variation 5322
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229683782"
variation 5327
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712562789"
variation 5328..5332
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aca"
/replace="acaca"
/db_xref="dbSNP:1712562041"
variation 5329
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1047689674"
variation 5332..5336
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ata"
/replace="atata"
/db_xref="dbSNP:930437337"
variation 5333
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1482969704"
variation 5335
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:762331235"
variation 5336
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164645"
variation 5337
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:920441740"
variation 5338
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:975019088"
variation 5341
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712559856"
variation 5344
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712559520"
variation 5349
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:927129743"
variation 5350
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:139496844"
variation 5355
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1211689435"
variation 5358
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1416945263"
variation 5360
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1712557721"
variation 5360
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:979917997"
variation 5361..5362
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ttaagt"
/db_xref="dbSNP:1712556711"
variation 5361
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712556889"
variation 5362
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:963301126"
variation 5363
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1273408158"
variation 5364
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:564260454"
variation 5370
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359410225"
variation 5371..5380
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tactt"
/replace="tactttactt"
/db_xref="dbSNP:1335258310"
variation 5376
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1467802723"
variation 5378
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712554154"
variation 5380
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="ttacct"
/db_xref="dbSNP:1712553480"
variation 5381
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1409006206"
variation 5383
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1453798329"
variation 5384
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:912008548"
variation 5389
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360326144"
variation 5391
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712551650"
variation 5392
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712551330"
variation 5395
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1441007746"
variation 5397
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1004867193"
variation 5400
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712550232"
variation 5401
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:950700747"
variation 5402
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1296596356"
variation 5404
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:554930937"
variation 5407
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:546242498"
variation 5411..5417
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gagag"
/replace="gagagag"
/db_xref="dbSNP:1712547872"
variation 5414
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:749763795"
variation 5418
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712547515"
variation 5419..5433
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cat"
/replace="catgaatcaacacat"
/db_xref="dbSNP:1411933085"
variation 5421
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:541868334"
variation 5424
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712546755"
variation 5426..5430
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ca"
/replace="caaca"
/db_xref="dbSNP:1207865943"
variation 5427
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438352407"
variation 5428
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1324273855"
variation 5432
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577877136"
variation 5433
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1018229301"
variation 5438
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712544644"
variation 5440
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712544290"
variation 5441
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164613"
variation 5445
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712543907"
variation 5446
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712543529"
variation 5452
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712543170"
variation 5453
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1266263871"
variation 5455
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:375090958"
variation 5463
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1001027465"
variation 5464
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1168136906"
variation 5466
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:776234603"
variation 5467
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:60851756"
variation 5470
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470554759"
variation 5473..5476
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1254925746"
variation 5475
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:958409548"
variation 5479
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2153164607"
variation 5483..5492
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="agtcccagtc"
/replace="agtcccagtcccagtc"
/db_xref="dbSNP:1712538599"
variation 5485
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712539284"
variation 5489
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1343758472"
variation 5495
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1455694799"
variation 5497
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1560294258"
variation 5498
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1560294245"
variation 5501
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042645076"
variation 5504
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1488104458"
variation 5505
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002819759"
variation 5509
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712536179"
variation 5516
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1403175070"
variation 5520
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:905593999"
variation 5523
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1346246896"
variation 5524
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:533805447"
variation 5525
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206352606"
variation 5531
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1318458651"
variation 5532
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274804236"
variation 5546
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712532935"
variation 5547..5549
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gtg"
/replace="gtgtg"
/db_xref="dbSNP:1712532242"
variation 5548
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1305480582"
variation 5549
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712531946"
variation 5550
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1264466969"
variation 5551
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1489760038"
variation 5553
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712530938"
variation 5556
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:891470830"
variation 5561
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1201147878"
variation 5562..5564
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1712530065"
variation 5569..5574
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:1273479587"
variation 5569
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:746516536"
variation 5570
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712529471"
variation 5573
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712529111"
variation 5574
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1268893637"
variation 5581
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1177081562"
variation 5601
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712527556"
variation 5605
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712527204"
variation 5608
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:553146498"
variation 5612
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1045525257"
variation 5614
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:777358559"
variation 5616
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:886113900"
variation 5617
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1234502917"
variation 5618
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1365172535"
variation 5619
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712524787"
variation 5620..5621
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="tct"
/db_xref="dbSNP:1712524107"
variation 5620
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712524437"
variation 5621..5623
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gtg"
/db_xref="dbSNP:1422914424"
variation 5621..5622
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ctgttaattaaattctgtctc"
/db_xref="dbSNP:1712523445"
variation 5621
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712523737"
variation 5622
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712522777"
variation 5622
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="ttaattaaattct"
/db_xref="dbSNP:1712523090"
variation 5623
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712522028"
variation 5624..5625
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ctcta"
/db_xref="dbSNP:1712521280"
variation 5624
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:566356269"
variation 5626
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712520926"
variation 5627..5628
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1712520586"
variation 5630
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:2153164575"
variation 5631
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712520233"
variation 5637
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1349455991"
variation 5638
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577876808"
variation 5639
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1047638370"
variation 5646
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366229360"
variation 5655
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1441593736"
variation 5660
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712518041"
variation 5661
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:927058993"
variation 5662
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:980375059"
variation 5663
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:941854112"
variation 5666
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357011167"
variation 5670
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1577876731"
variation 5673
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1224199708"
variation 5674
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1292075183"
variation 5674
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:147535199"
variation 5676
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:570584888"
variation 5680
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712514190"
variation 5681..5683
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1471473941"
variation 5681
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1201874147"
variation 5682
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231666441"
variation 5683
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712512828"
variation 5689
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1178296896"
variation 5690
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712512005"
variation 5693
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712511526"
variation 5696
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:983349457"
variation 5698
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:557104957"
variation 5700
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370710519"
variation 5701
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:568367898"
variation 5702
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443202423"
variation 5705
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299179640"
variation 5708
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:779796235"
variation 5716
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712508433"
variation 5722
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1165655021"
variation 5732..5735
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:201192684"
variation 5743..5747
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aa"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1369048343"
variation 5743
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712506935"
variation 5749
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1327013711"
variation 5751
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1356197580"
variation 5754..5763
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttta"
/replace="ttttatttta"
/db_xref="dbSNP:1174026581"
variation 5754
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:548134948"
variation 5758
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435539140"
variation 5759
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1397019221"
variation 5766
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712503273"
variation 5767
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712502933"
variation 5769
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:965191099"
variation 5773
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1017676262"
variation 5774
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:528473938"
variation 5775
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712501000"
variation 5777
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:966649413"
variation 5782..5784
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1212281656"
variation 5784..5786
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1408632937"
variation 5784
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712499856"
variation 5792
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712499123"
variation 5802
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1001058555"
variation 5803
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712498395"
variation 5806
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1437911032"
variation 5810
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1479547488"
variation 5811
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1250743054"
variation 5812
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712496892"
variation 5813
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712496554"
variation 5817
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1243096132"
variation 5818
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:554505427"
variation 5819
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:377360279"
variation 5821
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1486442906"
variation 5823
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560293757"
variation 5824
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712493969"
variation 5827
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1166386478"
variation 5829
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1421688316"
variation 5831
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712493068"
variation 5836
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712492739"
variation 5838
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1277662294"
variation 5841
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2153164534"
variation 5842
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1410622941"
variation 5846
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712491626"
variation 5850
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:868656484"
variation 5854
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:12639920"
variation 5859
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:958307793"
variation 5865
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1316931454"
variation 5866..5868
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1034369730"
variation 5869
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712489349"
variation 5871
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1009833386"
variation 5874
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712488663"
variation 5876
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1325651563"
variation 5877
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560293657"
variation 5882
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225937654"
variation 5892
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349061975"
variation 5893..5902
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="attg"
/replace="attgacattg"
/db_xref="dbSNP:1288090873"
variation 5897
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:980939217"
variation 5899
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712486458"
variation 5906
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712485771"
variation 5908
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415686770"
variation 5910
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712484946"
variation 5915
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1222422916"
variation 5921
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:896698351"
variation 5923
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1377497348"
variation 5930
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1301246087"
variation 5931
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712483017"
variation 5933
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712482629"
variation 5939
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712482271"
variation 5943
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1465618368"
variation 5944
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:970897961"
variation 5946
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:747986630"
variation 5949
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712480599"
variation 5951
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1478169176"
variation 5954
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712479689"
variation 5955
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1198874071"
variation 5956
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161237442"
variation 5962
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:552298223"
variation 5963
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:778634280"
variation 5965
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1383920963"
variation 5969
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1398762510"
variation 5974..5975
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ct"
/db_xref="dbSNP:1319857509"
variation 5975
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141551237"
variation 5982
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:886227043"
variation 5984
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1403798752"
variation 5994
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712475429"
variation 5995
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1411040326"
variation 5996
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712474711"
variation 5998
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712474200"
variation 6001
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712473861"
variation 6002
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712473521"
variation 6005
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:905636799"
variation 6007
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1188391262"
variation 6008
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712472233"
variation 6010
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:563761973"
variation 6016
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:941759486"
variation 6028
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1039385056"
variation 6030..6031
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1712470661"
variation 6031..6036
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttttt"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:890297319"
variation 6031
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:148379497"
variation 6035
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1203792165"
variation 6036
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712469194"
variation 6040
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712468776"
variation 6041
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712468433"
variation 6046
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051759325"
variation 6049
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712467743"
variation 6054..6059
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1222039103"
variation 6055
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164462"
variation 6060
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:530204480"
variation 6062
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712466780"
variation 6065
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:754943722"
variation 6066
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1266777661"
variation 6074..6075
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="aaa"
/db_xref="dbSNP:1485928036"
variation 6080
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712465443"
variation 6081
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712465034"
variation 6085
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712463717"
variation 6088
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:983213943"
variation 6091
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:929217623"
variation 6092
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:923205542"
variation 6093
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712462205"
variation 6096
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:976519259"
variation 6100
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:964724976"
variation 6103
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:2153164449"
variation 6109
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1327683663"
variation 6111
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712460606"
variation 6115..6121
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttttttt"
/replace="tttttttt"
/db_xref="dbSNP:1360756948"
variation 6120
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1018000356"
variation 6122
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:568976344"
variation 6126
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1300915484"
variation 6127..6130
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="aaag"
/db_xref="dbSNP:1712458095"
variation 6127
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712458425"
variation 6132
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:35631273"
variation 6133
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1405078489"
variation 6135
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143324173"
variation 6136
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:59769412"
variation 6141
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1237318118"
variation 6146
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281578450"
variation 6148
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1354870104"
variation 6149
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1221971463"
variation 6151
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712449155"
variation 6153
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:961280434"
variation 6157
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:62304268"
variation 6158
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1210552527"
variation 6159
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1560293275"
variation 6161
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1035263438"
variation 6163
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1436071161"
variation 6165
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1290682128"
variation 6166
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1577875779"
variation 6169
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712445466"
variation 6173
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:970845794"
variation 6175
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1455643429"
variation 6177
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712444192"
variation 6181
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1386747723"
variation 6182
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1387828174"
variation 6188
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1165491697"
variation 6190
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1457962278"
variation 6198
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1297157939"
variation 6200
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1025143744"
variation 6206
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390100099"
variation 6207
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712441130"
variation 6208
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712440789"
variation 6209
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712440461"
variation 6212
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577875714"
variation 6213
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366459660"
variation 6214
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:756202450"
variation 6215
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:905544585"
variation 6220
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:552983335"
variation 6221
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1026509306"
variation 6226..6231
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ata"
/replace="ataata"
/db_xref="dbSNP:2153164406"
variation 6227
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:866806298"
variation 6228
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712437149"
variation 6241
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1250777992"
variation 6251
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1337538929"
variation 6252
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712436110"
variation 6253
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164402"
variation 6258
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712435734"
variation 6279
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712435364"
variation 6282
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1197446107"
variation 6283
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238765792"
variation 6284
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712434300"
variation 6285
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1460679011"
variation 6286
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712433590"
variation 6287
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1181593089"
variation 6292
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1244580172"
variation 6295
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712432490"
variation 6296
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712432129"
variation 6297
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1186117301"
variation 6299
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164393"
variation 6303
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1169314682"
variation 6305
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:2153164392"
variation 6312
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1370800668"
variation 6319
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712430522"
variation 6328
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577875587"
variation 6331
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463088750"
variation 6333
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005934869"
variation 6337
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712428910"
variation 6340
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712428525"
variation 6343
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:35620184"
variation 6351
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:898840293"
variation 6352..6353
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ttatat"
/db_xref="dbSNP:1712427393"
variation 6355
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1401715425"
variation 6357
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1452366850"
variation 6359
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1335213412"
variation 6359
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712425883"
variation 6361
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1381820293"
variation 6363
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1396757415"
variation 6364
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1295168359"
variation 6365
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712424350"
variation 6367
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560293002"
variation 6368
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560292993"
variation 6369
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1017488703"
variation 6371
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:887490227"
variation 6378
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268064595"
variation 6380
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:545956681"
variation 6383
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712421707"
variation 6385
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712421349"
variation 6389
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1047587842"
variation 6392
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1322804515"
variation 6397
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1201701864"
variation 6402..6404
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="agt"
/db_xref="dbSNP:1356792873"
variation 6402..6403
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ag"
/db_xref="dbSNP:1007434230"
variation 6408
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712419033"
variation 6414
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712418675"
variation 6417
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:929141668"
variation 6418
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1185522338"
variation 6419
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1259292676"
variation 6421
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1429744690"
variation 6432
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712416881"
variation 6434
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:180801584"
variation 6436
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712416035"
variation 6437
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:796681164"
variation 6438
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712415253"
variation 6439
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712414920"
variation 6440
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1308300698"
variation 6441
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1361224352"
variation 6442
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:943250633"
variation 6447
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466899270"
variation 6449
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:945240500"
variation 6450
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:866442069"
variation 6451
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:556755406"
variation 6459
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1326533820"
variation 6461
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1401907442"
variation 6463
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712411186"
variation 6464
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1442975028"
variation 6469
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344970939"
variation 6477
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1221566766"
variation 6478
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373441554"
variation 6483
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2153164356"
variation 6487
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712408319"
variation 6488
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1162420037"
variation 6495
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1462236328"
variation 6496
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1214857684"
variation 6498
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258579490"
variation 6499
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153164351"
variation 6506
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712406456"
variation 6510
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:968161562"
variation 6518
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712405759"
variation 6525
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1560292783"
variation 6530
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1166264176"
variation 6532
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448371884"
variation 6533
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712404303"
variation 6537
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1253033163"
variation 6541
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712403574"
variation 6543
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267476614"
variation 6547
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1479189920"
variation 6548
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712402590"
variation 6550
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712402171"
variation 6561
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1197837028"
variation 6562
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712401484"
variation 6564
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712401109"
variation 6566
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:913982530"
variation 6582
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712400403"
variation 6584
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:988338518"
variation 6587
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712399770"
variation 6589
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427931263"
variation 6606
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712399338"
variation 6610
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1434112495"
variation 6612..6617
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="tcttta"
/db_xref="dbSNP:1712398626"
variation 6619
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1158906305"
variation 6631..6633
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1712398015"
variation 6633
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:750509346"
variation 6639
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1035576826"
variation 6648
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:149620523"
variation 6649
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712396444"
variation 6658
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265775024"
variation 6664
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:970010784"
variation 6678
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368301849"
variation 6680
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712394945"
variation 6681
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:980832835"
variation 6688
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712394195"
variation 6690
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1222984486"
variation 6691
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:188330402"
variation 6698
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1355593878"
variation 6709
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277067600"
variation 6712
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:918200461"
variation 6713
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:554480588"
variation 6714
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:982928112"
variation 6716
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1005839892"
variation 6725
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1560292640"
variation 6727
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712390641"
variation 6743
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1248947200"
variation 6746
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1177137498"
variation 6747
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:918986522"
variation 6749
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:973571459"
variation 6751
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1341597110"
variation 6756
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422818636"
variation 6761..6766
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ac"
/replace="acttac"
/db_xref="dbSNP:2153164299"
variation 6765
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1712387667"
variation 6772
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712387200"
variation 6775
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:887555996"
variation 6776
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712386380"
variation 6788..6798
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tctcgggaaat"
/replace="tctcgggaaatctcgggaaat"
/db_xref="dbSNP:1236480312"
variation 6789
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153164296"
variation 6790
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1350556276"
variation 6791
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1047451390"
variation 6792
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:993629499"
variation 6795
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:571030507"
variation 6809
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296417615"
variation 6812
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712383756"
variation 6818
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:534599389"
variation 6825
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:138298785"
variation 6826..6832
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tattatt"
/replace="tattattattatt"
/db_xref="dbSNP:1356897110"
variation 6828
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:901688726"
variation 6830
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577874937"
variation 6834
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712381385"
variation 6838
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1391773009"
variation 6841
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1007214782"
variation 6845
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1040575844"
variation 6846
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:943300959"
variation 6851
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1236935149"
variation 6852
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712378930"
variation 6853
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1459345539"
variation 6854
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1305829902"
variation 6855
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:910467396"
variation 6855
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1577874871"
variation 6859
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:954616520"
variation 6864
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:552135196"
variation 6871
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1009325087"
variation 6874
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:946689084"
variation 6878
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712375604"
variation 6880
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:914013637"
variation 6883
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:552919881"
variation 6884
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:751994166"
variation 6886
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1001355105"
variation 6890
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712372293"
variation 6891..6895
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1560292412"
variation 6892
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:187206998"
variation 6896
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1335767506"
variation 6898
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1380311021"
variation 6900
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1449711881"
variation 6901..6904
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="gttg"
/db_xref="dbSNP:377024392"
variation 6905..6907
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:35835434"
variation 6909
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712369181"
variation 6910
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712368834"
variation 6915..6921
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="gttcctg"
/db_xref="dbSNP:1212332357"
variation 6915
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712368457"
variation 6918
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:928163328"
variation 6920
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712368141"
variation 6921
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:570154648"
variation 6922..6940
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="gt"
/replace="gttttaaaacctattaagt"
/db_xref="dbSNP:1712365204"
variation 6926
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:949387217"
variation 6927
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2153164255"
variation 6931
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:981309943"
variation 6934
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:918148192"
variation 6935
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712366022"
variation 6938
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712365623"
variation 6941
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712364868"
variation 6951
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:375943538"
variation 6952
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1199836612"
variation 6954
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164249"
variation 6955
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:549960503"
variation 6956
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:527948349"
variation 6960
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:560288877"
variation 6961
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:984445304"
variation 6962
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1560292248"
variation 6963
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1560292237"
variation 6965
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189823886"
variation 6974
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:920093663"
variation 6976
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712359513"
variation 6982
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:770331840"
variation 6985
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:951732626"
variation 6988
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:7665824"
variation 6991
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425886077"
variation 6994
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:910332512"
variation 6997
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1175651054"
variation 7001
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712356516"
variation 7004
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712356319"
variation 7005
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:985743063"
variation 7010..7011
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1416008474"
variation 7012
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712355181"
variation 7014
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712354794"
variation 7015
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1334366865"
variation 7019
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1344306992"
variation 7023
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712353312"
variation 7025
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1428022766"
variation 7026
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1482845325"
variation 7030
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:954390730"
variation 7036
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:182169139"
variation 7038
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1202250996"
variation 7042
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1030170410"
variation 7043
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1202597132"
variation 7044
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153164223"
variation 7047
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1176763718"
variation 7056
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1009442568"
variation 7057
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:145729740"
variation 7058
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:993267836"
variation 7061
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1214726126"
variation 7063
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:772686956"
variation 7064
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1032579995"
variation 7068
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="t"
/db_xref="dbSNP:1712343543"
variation 7069
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:901548706"
variation 7070
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1239629299"
variation 7071..7075
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1352136994"
variation 7071
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712341691"
variation 7079
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:753973016"
variation 7081
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1408898313"
variation 7084
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1141790"
variation 7085
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406996535"
variation 7089
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314273380"
variation 7090
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1007794649"
variation 7095
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299690471"
variation 7099
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:889067650"
variation 7101
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360553455"
variation 7102
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:140504512"
variation 7104
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:946593937"
variation 7106
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1235874465"
variation 7108
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172550824"
variation 7111
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712335493"
variation 7112..7114
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="ata"
/db_xref="dbSNP:1288482620"
variation 7112
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1470786544"
variation 7113
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238177862"
variation 7118
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712334071"
variation 7121..7125
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1414726440"
variation 7126
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:563404333"
variation 7127
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1180468614"
variation 7129
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1488639398"
variation 7131
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:896498035"
variation 7140
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:115646620"
variation 7148..7150
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="cac"
/replace="cacac"
/db_xref="dbSNP:575699549"
variation 7148
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1453196995"
variation 7153
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1052831531"
variation 7159
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1362970575"
variation 7160
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:939455390"
variation 7161
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1212446429"
variation 7162
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:2153164189"
variation 7163
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712328964"
variation 7170
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1380574471"
variation 7173
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440800182"
variation 7175
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277963227"
variation 7176
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:190115304"
variation 7181
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1392262162"
variation 7183
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164185"
variation 7189
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712326733"
variation 7190
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388988387"
variation 7193
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1324804593"
variation 7195
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1335522602"
variation 7198
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:868551948"
variation 7199
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712324961"
variation 7201
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1205692636"
variation 7202
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1445079730"
variation 7203
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712323798"
variation 7204
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:554319167"
variation 7205
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712322831"
variation 7207
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1354761478"
variation 7208
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1331112339"
variation 7209
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712321751"
variation 7217..7221
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="agtta"
/db_xref="dbSNP:1358601805"
variation 7221
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1263688942"
variation 7226
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712320654"
variation 7232
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712320310"
variation 7234
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:185267474"
variation 7237
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712319614"
variation 7238..7245
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaat"
/replace="aaataaat"
/db_xref="dbSNP:1249794162"
variation 7244
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210310909"
variation 7249
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1456255457"
variation 7253
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:760995456"
variation 7257
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:572023269"
variation 7259
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:980997900"
variation 7260
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:115460634"
variation 7261
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:942908053"
variation 7262
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712315234"
variation 7271
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1560291657"
variation 7274..7278
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tctgt"
/db_xref="dbSNP:1369637773"
variation 7277
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:910271622"
variation 7279
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1355803019"
variation 7283
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712313397"
variation 7286
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712312987"
variation 7287
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712312646"
variation 7288
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:539026327"
variation 7290
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="t"
/db_xref="dbSNP:1712311935"
variation 7291
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:192273205"
variation 7294..7298
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttttt"
/replace="ttttttt"
/db_xref="dbSNP:1378115929"
variation 7294
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:550296533"
variation 7297
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153164148"
variation 7302
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1712310168"
variation 7304
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1339416866"
variation 7305
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1712309203"
variation 7308
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:867634398"
variation 7309..7310
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1401865977"
variation 7309
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:867326394"
variation 7313..7323
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttgcatgagtt"
/replace="ttgcatgagttgcatgagtt"
/db_xref="dbSNP:1342321809"
variation 7315
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712307773"
variation 7317
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:910029206"
variation 7321
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164140"
variation 7325
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1245668072"
variation 7335
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391476427"
variation 7337
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712305495"
variation 7338
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712305160"
variation 7343
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1316057818"
variation 7344
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1200473667"
variation 7345
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470431397"
variation 7349
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:984350405"
variation 7351
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:572430607"
variation 7357
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1179725139"
variation 7363
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:188617547"
variation 7368
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1423882718"
variation 7372
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712301655"
variation 7373
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1191918443"
variation 7376..7378
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1420855170"
variation 7381
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712300581"
variation 7386
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712300235"
variation 7388
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157511320"
variation 7396
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1457064071"
variation 7399
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712299042"
variation 7400
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:184320088"
variation 7404
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1025980795"
variation 7405
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:527860981"
variation 7407
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:768385949"
variation 7410
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712296291"
variation 7413..7420
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tggaattt"
/replace="tggaatttggaattt"
/db_xref="dbSNP:1237031630"
variation 7429
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712295084"
variation 7431..7433
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="aga"
/db_xref="dbSNP:1712294755"
variation 7433
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:987800132"
variation 7436
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712294072"
variation 7439
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:956818906"
variation 7441
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1032281414"
variation 7442
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:972135429"
variation 7444
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1338529677"
variation 7447
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:979650110"
variation 7448
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278816895"
variation 7452
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322521711"
variation 7454
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:749092925"
variation 7457
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164101"
variation 7458
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="c"
/db_xref="dbSNP:1712291186"
variation 7458
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:796109397"
variation 7461
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712290460"
variation 7467
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:969260266"
variation 7469
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712289696"
variation 7470
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:1712289381"
variation 7470
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712288880"
variation 7471
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023692841"
variation 7477
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712288146"
variation 7488
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712287838"
variation 7493
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2153164091"
variation 7497
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1019095058"
variation 7500
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712286975"
variation 7503
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712286674"
variation 7509
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1196442392"
variation 7513
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712285999"
variation 7516
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1013681650"
variation 7517
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="g"
/db_xref="dbSNP:1712285282"
variation 7521
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712284819"
variation 7522
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712284263"
variation 7524
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712283906"
variation 7526
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1432951674"
variation 7530
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:565582946"
variation 7536
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712282749"
variation 7542
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712282362"
variation 7545
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:896614194"
variation 7548
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2153164081"
variation 7550
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712281682"
variation 7551
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712281323"
variation 7552..7582
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ctccc"
/replace="ctcccaaaacttctcagcaaataaatctccc"
/replace="ctcccaaaacttctcagcaaataaatctcccaaaacttctcagcaaat
aaatctccc"
/db_xref="dbSNP:1712278800"
variation 7561..7565
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:1712281003"
variation 7566
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1007418313"
variation 7570
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712280349"
variation 7572
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1379733545"
variation 7576
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712279555"
variation 7581
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712279167"
variation 7590
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712278461"
variation 7595
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11940243"
variation 7596
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:994209826"
variation 7597
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712276788"
variation 7598
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:898725608"
variation 7604
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:879385418"
variation 7613
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1270348587"
variation 7615
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1298721977"
variation 7627
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1436663601"
variation 7629
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712274448"
variation 7632
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:761547767"
variation 7636
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303064188"
variation 7637
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712273329"
variation 7648
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712272992"
variation 7649
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:889953103"
variation 7654
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712272246"
variation 7662
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712271901"
variation 7665..7670
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gtgagc"
/db_xref="dbSNP:1712270850"
variation 7667
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712271556"
variation 7668
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1136694"
variation 7670
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712270488"
variation 7675..7680
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ta"
/replace="tagtta"
/db_xref="dbSNP:1238922756"
variation 7675
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1051243589"
variation 7677..7698
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="gttaaaaataatatttttatgt"
/db_xref="dbSNP:1712266521"
variation 7677
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712269752"
variation 7685
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712268996"
variation 7686
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1457203980"
variation 7689
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1577873412"
variation 7693
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:146802075"
variation 7696
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1434972189"
variation 7701
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216774677"
variation 7704
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1010837437"
variation 7705
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:933062476"
variation 7706
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488400598"
variation 7708
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712264626"
variation 7715
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577873359"
variation 7720
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712263838"
variation 7725
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189992656"
variation 7726
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1269847006"
variation 7727
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:923051224"
variation 7732
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1158254090"
variation 7737
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378765703"
variation 7739
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:892349403"
variation 7740
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712261351"
variation 7741
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712260965"
variation 7748
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712260650"
variation 7756
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1350881302"
variation 7758
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712259900"
variation 7762
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:563131271"
variation 7763
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:543530590"
variation 7767..7772
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1712258020"
variation 7767
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:756043784"
variation 7773
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:935029050"
variation 7775
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368001985"
variation 7783
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712257006"
variation 7788..7789
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1712256663"
variation 7793
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712256337"
variation 7799
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1445836851"
variation 7802
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712255590"
variation 7804..7805
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="ag"
/db_xref="dbSNP:1712255248"
variation 7808
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306610220"
variation 7811
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1355490093"
variation 7816
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1240424800"
variation 7817
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712253852"
variation 7823
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1288450629"
variation 7834
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712253152"
variation 7841
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:906641770"
variation 7843..7846
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1712252526"
variation 7847
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:191420358"
variation 7848
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:560613944"
variation 7849
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:540848366"
variation 7851..7861
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="taaag"
/replace="taaagataaag"
/db_xref="dbSNP:1468849814"
variation 7852
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1712250892"
variation 7855
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1187908656"
variation 7860
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712249959"
variation 7862
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1236739203"
variation 7863
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:969590050"
variation 7866
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712248895"
variation 7877
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179522468"
variation 7880
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413114918"
variation 7881..7885
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1166803252"
variation 7882
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248310493"
variation 7890..7891
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="a"
/db_xref="dbSNP:1712247038"
variation 7892
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1350456742"
variation 7906
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464901980"
variation 7907
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1219117393"
variation 7908
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378852047"
variation 7913
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:750514344"
variation 7914
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712244986"
variation 7915
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712244645"
variation 7922
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:367696386"
variation 7925
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:992029127"
variation 7929
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376322577"
variation 7933
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:3200171"
variation 7935
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:960768532"
variation 7936
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273296521"
variation 7937
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1292641676"
variation 7940
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1336020989"
variation 7941
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1198589099"
variation 7946..7949
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1712240233"
variation 7949..7950
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="taac"
/db_xref="dbSNP:1712239538"
variation 7949
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1256509115"
variation 7953
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:187621752"
variation 7958
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1459395227"
variation 7959
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712238477"
variation 7960
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712238166"
variation 7961
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1230105908"
variation 7963
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:984213143"
variation 7964
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1237168499"
variation 7966
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1712236713"
variation 7968
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025757746"
variation 7974
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:774368811"
variation 7980
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712235550"
variation 7985
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:898510392"
variation 7988
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477420415"
variation 7993..7995
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="cac"
/db_xref="dbSNP:1712234598"
variation 7995
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1577872935"
variation 7996..8000
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1712233914"
variation 8001
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1168470458"
variation 8002
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402144908"
variation 8003..8006
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="ta"
/replace="tata"
/db_xref="dbSNP:762143714"
variation 8008
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1228380457"
variation 8009
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1017564096"
variation 8011
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1357140364"
variation 8021
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1295730893"
variation 8023
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284217086"
variation 8025..8031
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tatt"
/replace="tattatt"
/db_xref="dbSNP:1339304533"
variation 8029..8033
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace=""
/replace="atttc"
/db_xref="dbSNP:1712230475"
variation 8033
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1007138529"
variation 8035
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:757584519"
variation 8040
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712229147"
variation 8046..8050
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1712228139"
variation 8046
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1320421845"
variation 8047
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1712228485"
variation 8053
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712227816"
variation 8058
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051192481"
variation 8066
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:751763585"
variation 8069
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:966083059"
variation 8070
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:998331243"
variation 8072
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1440841087"
variation 8073
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1708458838"
variation 8085
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:183911974"
variation 8086
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1258251573"
variation 8088
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712224960"
variation 8096
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:901575165"
variation 8097
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:911540396"
variation 8098
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577872739"
variation 8101
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191372738"
variation 8103
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:558437721"
variation 8104
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1712222860"
variation 8109..8113
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="taatt"
/db_xref="dbSNP:568769077"
variation 8109
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1712222527"
variation 8111
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1577872717"
variation 8118
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:985892560"
variation 8124
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712221040"
regulatory 8128..8133
/regulatory_class="polyA_signal_sequence"
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/note="hexamer: AATAAA"
variation 8128
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1388465394"
variation 8129
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1712220373"
variation 8130
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1415775424"
variation 8131
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:953075651"
variation 8134
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1334438428"
variation 8135..8137
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1712219092"
variation 8138
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1022141986"
variation 8141
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359317667"
variation 8145
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1168034458"
polyA_site 8151
/gene="ATP8A1"
/gene_synonym="ATPASEII; ATPIA; ATPP2"
/note="major polyA site"
ORIGIN
aagagctcgcccagctctgcgggcgccgccaccttcgccgccaccgctgcctttctcctcctcctgtcggcgtgcgggggccgcgcccggcggcagctctgccctaggtgggcggcggcgcggcccaggctgcagctgagcgctctgcgcggcgcagccgggtctcccgcgtgtaccacgccgtgacaggtgcagagtccgggctgaggacccacctgcagccgccgccgcgatgcccaccatgcggaggaccgtgtcggagatccgctcgcgcgccgaaggttatgagaagacagatgatgtttcagagaagacctcactggctgaccaggaggaagtaaggactattttcatcaaccagccccagctgacaaaattctgcaataaccatgtcagcactgcaaaatacaacataatcacattccttccaagatttctctactctcagttcagaagagctgctaattcattttttctctttattgcactgctgcagcaaatacctgatgtgtcaccaacaggtcgttatacaacactggttcctctcttatttattttagctgtggcagctatcaaagagataatagaagatattaaacgacataaagctgataatgcagtgaacaagaaacaaacgcaagttttgagaaatggtgcttgggaaattgtccactgggaaaagtgagccccaagccatgtgctacattgaaacatccaacttagatggtgaaacaaacttgaaaattagacagggcttaccagcaacatcagatatcaaagacgttgacagtttgatgaggatttctggcagaattgagtgtgaaagtccaaacagacatctctacgattttgttggaaacataaggcttgatggacatggcaccgttccactgggagcagatcagattcttcttcgaggagctcagttgagaaatacacagtgggttcatggaatagttgtctacactggacatgacaccaagctgatgcagaattcaacaagtccaccacttaagctctcaaatgtggaacggattacaaatgtacaaattttgattttattttgtatcttaattgccatgtctcttgtctgttctgtgggctcagccatttggaatcgaaggcattctggaaaagactggtatctcaatctaaactatggtggcgctagtaattttggactgaatttcttgaccttcatcatccttttcaacaatctcattcctatcagcttattggttacattagaagttgtgaaatttacccaggcatacttcataaattgggatcttgacatgcactatgaacccacagacactgctgctatggctcgaacatctaatctgaatgaggaacttggccaggttaaatacatattttctgacaaaactggtactctgacatgcaatgtaatgcagtttaagaagtgcaccatagcgggagttgcttatgggcagaactcacagtttggagatgaaaaaacatttagtgattcatcattgctggaaaatctccaaaataatcatccaactgcacctataatatgtgaatttcttacaatgatggcagtctgtcacacagcagtgccagagcgagaaggtgacaagattatttatcaagcagcatctccagatgagggagcattggtcagagcagccaagcaattgaattttgttttcactggaagaacacccgactcggtgattatagattcactggggcaggaagaaagatatgaattgctcaatgtcttggagtttaccagtgctaggaaaagaatgtcagtgattgttcgcactccatctggaaagttacgactctactgcaaaggagctgacactgtaatttatgatcgactggcagagacgtcaaaatacaaagaaattaccctaaaacatttagagcagtttgctacagaagggttaagaactttatgttttgctgtggctgagatttcagagagcgactttcaggagtggcgagcagtctatcagcgagcatctacatctgtgcagaacaggctactcaaactcgaagagagttatgagttgattgaaaagaatcttcagctacttggagcaacagccattgaggataaattacaagatcaagtgcctgaaaccatagaaacgctaatgaaagcagacatcaaaatctggatccttacaggggacaagcaagaaactgccattaacatcggacactcctgcaaactgttgaagaagaacatgggaatgattgttataaatgaaggctctcttgatggaacaagggaaactctcagtcgtcactgtactacccttggtgatgctctccggaaagagaatgattttgctcttataattgatgggaaaaccctcaaatatgccttaacctttggagtacgacagtatttcctggacttagctttgtcatgcaaagctgtcatttgctgtcgggtttctcctcttcaaaaatctgaagttgttgagatggttaagaaacaagtcaaagtcgtaacgcttgcaatcggtgatggagcaaatgatgtcagcatgatacagacagcgcacgttggtgttggtatcagtggcaatgaaggcctgcaggcagctaattcctctgactactccatagctcagttcaaatatttgaagaatttactgatgattcatggtgcctggaactataacagagtctccaagtgcatcttatactgcttctacaagaatatagtgctctatattatcgagatctggtttgcctttgttaatggcttttctggacagatcctctttgaaagatggtgtataggtctctataacgtgatgtttacagcaatgcctcctttaactcttggaatatttgagagatcatgcagaaaagagaacatgttgaagtaccctgaattatacaaaacatctcagaatgccctggacttcaacaccaaggttttctgggttcattgtttaaatggcctcttccactcagttattctgttttggtttccactaaaagcccttcagtatggtactgcatttggaaatgggaaaacctcggattatctgctactgggaaactttgtgtacacttttgtggtgataactgtgtgtttgaaagctggattggagacatcatattggacatggttcagccacatagcgatatgggggagcatcgcactctgggtggtgttttttggaatctactcatctctgtggcctgccattccgatggcccctgatatgtcaggagaggcagccatgttgttcagttctggagtcttttggatgggcttgttattcatccctgtggcatctctgctccttgatgtggtgtacaaggttatcaagaggactgcttttaaaacattggtcgatgaagttcaggagctggaggcaaaatctcaagacccaggagcagttgtacttggaaaaagcctgaccgagagggcgcaactgctcaagaacgtctttaagaagaaccacgtgaacttgtaccgctctgaatccttgcaacaaaatctgctccatgggtatgcgttctctcaagatgaaaatggaatcgtttcacagtctgaagtgataagagcatatgataccacgaaacagaggcccgacgaatggtgatggggagagcctgaaaggcaggctctgttacctctctaaggagagctaccaggttgtcaccgcagtctgctaaccaattccagtctggtccatgaagaggaaaggtagatctgagctcatctcgctgatggacattcagattcatgtatattatagacataagcactgtgcaactgtactgtaacaccatctcttttggatttttttaaggtatttgctaagtctttgtaaacggaaattgaaaatgacctggtatcttgccagagggctttcttaaacggagaataagtcagtattcttatgccattactgtggggctgtaactgactgtcagtttattggctgtaccacaaggtaaccaaccattaaaaaactctaaatgatatttagttaaagggactcttggtatccagacttagatttcaggatatgctgaaacaaaccagcattcttaaggaactgactcaccttcctgagcaaaatttctaaacaagcatttgtgtccaaaattgtcttgataaatgtttgccaaagaggttcagtaagtgtttttctagttcagtagtcatatgcccagaaatgtaagagaaagtttacttccagttccgctgtaagatctgcatgcctgactttccaaatgtaagagtgatttacaaaaatgaatatttcaaggcatttgctactaaaatcggtgatgttgcacctttggccttacaaatgcttctttgttgtttgtcgtgtttatttgttagaggacacacgtgttaatgtgactctgttgttatgacactgatttttcaaactatgtatgtttcaggtatttctgatgaagtttcatcatcatttagatttttctaaaaatctggctaatgcagtagattgagtgatgtcattttgtcttaaagtttttcctcttaagaaacatatgctacgtatttacgtgggatttccaaagcttctgttgcaatatttggaataacatgtcagataaatgcatgggcttttgtcctgtgttccagttcccactagagatgcctgtgtcttgtgtagcacacccagtgttatggtgactgccccctatactgaagactgaaaattatttcacagttcactcatcaaatagttcccaaaattcgtcacatgctgcttattgggacaaataggtagtacattttccccatttaaaaaatgcggattttactcaggccggtaactttacagtcagaggacacgttcatcatgagtagcttttgttagtatgttttaaaatgtatcttcagttcaattattttcagcatttacaagacatctgaaaatggctattttgctaccaacagtaaatgaaggggctgtttaaaaaccacaaccagttttctacactattttttaaataatactttcatttgaaaaaaaggaattagttttcagatacacttcagagattgaagcaaactatttgccttttactcaaaagcctgcttgcctttacatggacttaccagcaaaataggtagaactttctcttttaaaaaaagtcaactagaattgagaagaggtgattttttttcagatcgcttctcgagtttaatattttcacattcttttcaccctttttctcaatctagatttaaaattaggatatatgtcatttccttgtctgtatttgtagctccttagttaccagtatgcctctccattttctacaaataagaggttataacacatatacataattctaaccttaagggaacacacgtttacatactttacttcccaagcccttcctgtttggggtacagattgagagagtcatgaatcaacacatctagcaagaccacaggtgtaagagtctaagatcgtcttcaaaattctgaagtcccagtctttacctgtccagtgaatgaatattcagagcagcttttcctgggcttcccagtggtgatagctgaggtcaaaccacaaaaaataagaaagcaagagtgaaatgcacccctccagagaaacactttgtagtgtttaattctgttaatagagaagagctgcttctgtttgcgctcacttcatcagtggcacccttctgcagaattttaatataaaaacattatggatataatagaactggattttctgacttaaaaatgtaagttttattttaatcttgaaacgtggattgtttctgtggagctcttaaacatgagaagaatacttacggttgataatgtgtaacatgatctgaaatgtgactaatttgagcctctttgtcccatcgtcctgtttttgaattattgacattgtcagtctctttgcttcctgggtgagacttggggtttgagggacagggaatgaccttcttggtgaaacttaaaatataacattgcaattgcagtgactttacagtgttaaattagagaaaatagtctgattttttaaaccttccttaactggaaaaaagtcacatggttttaccaggattgaaataaacagtcaatgtgacttttaacatgtgtttttttgaaataaagggcacgtactcttcaattaaaaagttccttatagggactctggcaaatgctaacacagttgctttacaatgtttacaattcagacaatacgacttataatagaaaatcctcattcatttagcattgaaaagctggaagttgcttctttaatgttgaatagtatacagtggtattgagcatggactttctaaatgttttatatatacatataaaaatatattggtgtctcacacccagaaagatgttatattgtagatattattaggaaaacagtgtttctcaggaacgttgtaaattttaaatgatatatgtacttcccgtcctcccacctccactctgtgctctaatgtgagactgcttcagcagtgttgctaagttaatggaaaactttttctaatcaagtcaggtgaatgtgtattctgctaaataatgttagccatttacatgaattgtatggtcattaaatggaatcagtgattcctctttaatttccagaggggaaatgaattatggaaatcagtcagcattctgatcattaaattttatactttaattttgccgttcagcattctaaatatccaatgtgaaagtcacatgataatttgttttgcattgcgtgcactgtacaacacttacaacttgtcatttaaaatgttttctcgggaaatgaatgctagtcagaaagtaatagattgtattattcatagttttaaaattatgacaatgtcataattactacaaagctaaataatcgtgtttatttttgtgcagttgccctttgatagttcctggttttaaaacctattaagtgtataatcttacaaatagtcatctacaaaatttatggagaaagtgcccagcccattcacatcacatggaccaggaattcttttgtaaatgacttaaggtaacatcatgcagttcagtgcctaataaatgctttttaatgatgaacatttctataatgactcgtaagataccatagtctgatttttctcacattaaaataactgaagtcacttgtgtaacgtagttatactttgctgcattttaattaaccttcaacagctattaaagtggaatgtaagttaaattttgaaggaaaggaaataaatgttttccatatttcgtcttgatttactttctgtatgagaacagctgtgtttttgataggtttatggtttgcatgagttcatatttaaagtgatccaggccaatgcatggctattgctgtaaatcttgatgtttatttctgccttgtaaagttctatcacggcctacctggaatttaaaattcagtagacaaattaattggtcctctgcacaacttttttaataagtagattattttacaaagaaatttgaacaaatttaattgaatcttttgtttagcttgcctctaagaacttttcttaataaagctcccaaaacttctcagcaaataaatctcccttaagtaggaaagctagatttcatatttgcttactttgaattaacagcaactttccacaggtaaatctgttcttgcaaagatgtgagcagaatagttaaaaataatatttttatgtttcatggttctaaatggaagccataaatgcagtaaatactatctgttgtttaactactttaatcgtcattttttacattttcaagtttattaggttaagaaaaacagggcagccttggaaggcagctactacagaaaactgcagttttgcgttaaagataaagtagtattttcagctccctgaaaaaccattcctgctgaaactgctgtagaaattgtgaagctgcatgagtggagagtattgaatctgtggttatagtagttttctcaggtttgtttatcttgatgtttgatgcactgtgttttatagttattaaaattgagtaatattatttctatgcagtgttatgtgtcattggccttttgtgaatgtgcatgttttaaactgcaaattttaaacattttgtcctctaattgttattaaaaatgaaataaactttaccattacttaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]