ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-13 07:30:01, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001349369 1125 bp mRNA linear PRI 27-APR-2025
DEFINITION Homo sapiens centromere protein K (CENPK), transcript variant 5,
mRNA.
ACCESSION NM_001349369 XM_017009699
VERSION NM_001349369.2
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1125)
AUTHORS Li,G., Shen,J., Cheng,W., Wang,X., Wang,D., Song,Y., Chen,Y.,
Li,X., Zhang,M., Ding,Y., Ma,X., Qian,Q., Zhang,G., Ji,J. and
Liu,B.
TITLE CENPK orchestrates ovarian cancer progression via GOLPH3-Mediated
activation of mTOR signaling
JOURNAL Mol Cell Endocrinol 589, 112253 (2024)
PUBMED 38670220
REMARK GeneRIF: CENPK orchestrates ovarian cancer progression via
GOLPH3-Mediated activation of mTOR signaling.
REFERENCE 2 (bases 1 to 1125)
AUTHORS Li,X., Han,Y.R., Xuefeng,X., Ma,Y.X., Xing,G.S., Yang,Z.W.,
Zhang,Z., Shi,L. and Wu,X.L.
TITLE Lentivirus-mediated short hairpin RNA interference of CENPK
inhibits growth of colorectal cancer cells with overexpression of
Cullin 4A
JOURNAL World J Gastroenterol 28 (37), 5420-5443 (2022)
PUBMED 36312839
REMARK GeneRIF: Lentivirus-mediated short hairpin RNA interference of
CENPK inhibits growth of colorectal cancer cells with
overexpression of Cullin 4A.
REFERENCE 3 (bases 1 to 1125)
AUTHORS Tian,T., Chen,L., Dou,Z., Yang,Z., Gao,X., Yuan,X., Wang,C.,
Liu,R., Shen,Z., Gui,P., Teng,M., Meng,X., Hill,D.L., Li,L.,
Zhang,X., Liu,X., Sun,L., Zang,J. and Yao,X.
TITLE Structural insights into human CCAN complex assembled onto DNA
JOURNAL Cell Discov 8 (1), 90 (2022)
PUBMED 36085283
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1125)
AUTHORS Tian,H., Wang,F., Deng,Y., Ying,L., Fang,W., Chen,D., Miao,C.,
Li,H., Sun,S., Ma,Y., Cai,H. and Guo,T.
TITLE Centromeric protein K (CENPK) promotes gastric cancer proliferation
and migration via interacting with XRCC5
JOURNAL Gastric Cancer 25 (5), 879-895 (2022)
PUBMED 35715658
REMARK GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
proliferation and migration via interacting with XRCC5.
REFERENCE 5 (bases 1 to 1125)
AUTHORS Lin,X., Wang,F., Chen,J., Liu,J., Lin,Y.B., Li,L., Chen,C.B. and
Xu,Q.
TITLE N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
cervical cancer stemness and chemoresistance
JOURNAL Mil Med Res 9 (1), 19 (2022)
PUBMED 35418160
REMARK GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
promotes cervical cancer stemness and chemoresistance.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 1125)
AUTHORS Okada,M., Cheeseman,I.M., Hori,T., Okawa,K., McLeod,I.X.,
Yates,J.R. 3rd, Desai,A. and Fukagawa,T.
TITLE The CENP-H-I complex is required for the efficient incorporation of
newly synthesized CENP-A into centromeres
JOURNAL Nat Cell Biol 8 (5), 446-457 (2006)
PUBMED 16622420
REFERENCE 7 (bases 1 to 1125)
AUTHORS Foltz,D.R., Jansen,L.E., Black,B.E., Bailey,A.O., Yates,J.R. 3rd
and Cleveland,D.W.
TITLE The human CENP-A centromeric nucleosome-associated complex
JOURNAL Nat Cell Biol 8 (5), 458-469 (2006)
PUBMED 16622419
REFERENCE 8 (bases 1 to 1125)
AUTHORS Obuse,C., Yang,H., Nozaki,N., Goto,S., Okazaki,T. and Yoda,K.
TITLE Proteomics analysis of the centromere complex from HeLa interphase
cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
the CEN-complex, while BMI-1 is transiently co-localized with the
centromeric region in interphase
JOURNAL Genes Cells 9 (2), 105-120 (2004)
PUBMED 15009096
REFERENCE 9 (bases 1 to 1125)
AUTHORS Yamashita,A., Ito,M., Takamatsu,N. and Shiba,T.
TITLE Characterization of Solt, a novel SoxLZ/Sox6 binding protein
expressed in adult mouse testis
JOURNAL FEBS Lett 481 (2), 147-151 (2000)
PUBMED 10996314
REFERENCE 10 (bases 1 to 1125)
AUTHORS Taki,T., Hayashi,Y., Taniwaki,M., Seto,M., Ueda,R., Hanada,R.,
Suzukawa,K., Yokota,J. and Morishita,K.
TITLE Fusion of the MLL gene with two different genes, AF-6 and
AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
and 11 in infant leukemia
JOURNAL Oncogene 13 (10), 2121-2130 (1996)
PUBMED 8950979
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BG502832.1, BG505115.1, BC005400.1 and AC016620.7.
On May 31, 2019 this sequence version replaced NM_001349369.1.
Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
300065)-associated centromeric complex that targets CENPA (MIM
117139) to centromeres and is required for proper kinetochore
function and mitotic progression (Okada et al., 2006 [PubMed
16622420]).[supplied by OMIM, Mar 2008].
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a
portion of the 5' coding region, initiates translation at a
downstream start codon, and contains an alternate terminal exon,
resulting in a novel 3' coding region, compared to variant 1. The
encoded isoform (5) has a shorter N-terminus and a distinct
C-terminus compared to isoform 1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: SRR1163655.583260.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA1965299,
SAMEA1966682 [ECO:0006172]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-41 BG502832.1 2-42
42-444 BG505115.1 10-412
445-815 BC005400.1 449-819
816-1125 AC016620.7 70827-71136
FEATURES Location/Qualifiers
source 1..1125
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q12.3"
gene 1..1125
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="centromere protein K"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
exon 1..71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1359976795"
variation 2..3
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ca"
/db_xref="dbSNP:2482551133"
variation 2
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313487734"
variation 3
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752349587"
variation 6
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752348893"
variation 7
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1752348579"
variation 8
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306504051"
variation 9
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1342831242"
variation 10
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482550745"
variation 11..20
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ggggctggca"
/replace="ggggctggcaggggctggca"
/db_xref="dbSNP:1485277906"
variation 11
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752347563"
variation 12
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231982437"
variation 13
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028359789"
variation 14
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:542352928"
variation 15
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210224911"
variation 16
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482550477"
variation 19
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1265798087"
variation 20
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482550245"
variation 21
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752345149"
variation 22..25
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gc"
/replace="gcgc"
/db_xref="dbSNP:1257636747"
variation 22
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482550132"
variation 24
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1226707165"
variation 25
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2482549984"
variation 26
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482549940"
variation 27
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482549869"
variation 28
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752344063"
variation 29
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752343711"
variation 30
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:748792667"
variation 31
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1422047918"
variation 32
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1412446096"
variation 33
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1473419782"
variation 34
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150581284"
variation 35
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752342051"
variation 36
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1343690787"
variation 37
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:140804671"
variation 38
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482549285"
variation 39
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:553552680"
variation 40
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752340528"
variation 41
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:9791024"
variation 42
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404435189"
variation 45
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1413477558"
variation 46
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1011178654"
variation 48
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:892736211"
variation 49
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1293152372"
variation 50
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1752337962"
variation 51
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482548809"
variation 52
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1004353263"
variation 53
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1364825946"
variation 54
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482548656"
variation 55
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752336831"
variation 56
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:41268429"
variation 57
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482548493"
variation 58
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482548429"
variation 61
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027093258"
variation 62
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1003673595"
variation 63
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:995243929"
variation 64
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:558001621"
variation 69
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1368732818"
variation 71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157875168"
exon 72..173
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 72
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:548499564"
variation 75..77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tag"
/replace="tagttag"
/db_xref="dbSNP:1038778849"
variation 77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757254302"
variation 81
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2482497800"
variation 84
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1751964644"
variation 85
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225478568"
variation 86
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1375448951"
variation 90
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751963569"
variation 93
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001509723"
variation 94
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1445804221"
variation 99
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171663462"
variation 100
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2482497185"
variation 101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581126138"
variation 103
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1374448596"
variation 104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:906122153"
variation 107
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:902390139"
variation 114
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1470058908"
variation 115
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751960081"
variation 119
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1581126047"
misc_feature 126..128
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="upstream in-frame stop codon"
variation 127
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150571791"
variation 129
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1358207757"
variation 130
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173365559"
variation 131
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751958616"
variation 133
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1330586449"
variation 134
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1337771016"
variation 135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401876701"
variation 137
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1440214129"
variation 138
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2482495781"
variation 140
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1581125889"
variation 145
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751955831"
variation 146
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751955343"
variation 148
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409398045"
variation 154
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2482495294"
variation 155
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:189373120"
variation 159
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482495134"
variation 164
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482495039"
variation 165
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1158620897"
variation 166
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482494828"
variation 167
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482494751"
variation 168
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751953447"
variation 170
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1024707099"
variation 171
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:950264084"
variation 172
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1013728629"
variation 173
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1053275890"
exon 174..275
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 175
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757460492"
variation 176
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482312145"
variation 177
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777895549"
variation 181
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2096371242"
variation 182
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482311864"
variation 183
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:935938524"
variation 186
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150532568"
variation 187
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:758896315"
variation 188
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:75497175"
variation 190
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1216026136"
variation 193
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:371070860"
variation 196
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2482311210"
variation 200
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1750726023"
variation 201
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:760004670"
variation 202
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750725249"
variation 205
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482310879"
variation 206
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2482310811"
variation 210
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397513933"
variation 211
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750724525"
variation 212
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:754218341"
variation 213
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:766178671"
variation 217
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:760347848"
variation 219
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1348543974"
variation 222..226
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="actga"
/db_xref="dbSNP:1429400174"
variation 224
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:772652364"
variation 225..233
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gaagaa"
/replace="gaagaagaa"
/db_xref="dbSNP:1347528124"
variation 228
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482310072"
variation 230
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423115596"
variation 231
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750721303"
variation 234
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150574725"
variation 235
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2482309677"
variation 236..237
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ta"
/db_xref="dbSNP:2482309508"
variation 236
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:201745679"
variation 238
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481438294"
variation 239
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:774283954"
variation 240
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141729484"
variation 243
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206680426"
variation 247
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1581093357"
variation 251
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482309052"
variation 253..255
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1437145639"
variation 253
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248409774"
variation 254
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750716760"
CDS 255..836
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="isoform 5 is encoded by transcript variant 5;
leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
Solt; protein AF-5alpha; interphase centromere complex
protein 37"
/codon_start=1
/product="centromere protein K isoform 5"
/protein_id="NP_001336298.1"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
/translation="
MWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEVLSALG"
misc_feature 255..821
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="Centromere-associated protein K; Region: CENP-K;
pfam11802"
/db_xref="CDD:463355"
variation 255
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2482308685"
variation 256
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:749111718"
variation 260
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750714903"
variation 261
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263513424"
variation 264
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:775244207"
variation 265
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2482308277"
variation 267
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:771118232"
variation 268
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747252575"
variation 273
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868732343"
exon 276..332
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 276
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750271640"
variation 277
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:543487501"
variation 278
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043343369"
variation 279
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750268417"
variation 281
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482240161"
variation 284
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482240063"
variation 290
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448020199"
variation 291
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:762865136"
variation 292
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482239778"
variation 294
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775330841"
variation 296
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:148016416"
variation 297
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750263924"
variation 298..300
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ttg"
/db_xref="dbSNP:779227890"
variation 298
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1454849271"
variation 300
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:144481454"
variation 301
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150519689"
variation 303
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:745593902"
variation 306
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482238896"
variation 308..319
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aacactcaccga"
/db_xref="dbSNP:1242902542"
variation 308
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2482238798"
variation 310..316
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="cac"
/replace="cactcac"
/db_xref="dbSNP:757802386"
variation 310
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:946304876"
variation 311
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482238648"
variation 312
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:138527872"
variation 314
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339735347"
variation 315
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482238507"
variation 316
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150519582"
variation 317
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757907403"
variation 318
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141548635"
variation 320
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482237980"
variation 322
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:201709067"
variation 323
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482237910"
variation 324
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482237830"
variation 329
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:755596314"
variation 330
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:764377925"
variation 331
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482237506"
variation 332
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2482237390"
exon 333..405
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 334
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:749320661"
variation 335
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:780631678"
variation 337
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2482205689"
variation 338..340
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="att"
/db_xref="dbSNP:2482205276"
variation 338
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482205552"
variation 339..343
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttgtt"
/db_xref="dbSNP:1750067937"
variation 339
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750068401"
variation 344
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482204968"
variation 347
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750067487"
variation 349
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:532263854"
variation 350
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328421596"
variation 351
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750066060"
variation 352
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482204117"
variation 353
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1750065565"
variation 354
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278922834"
variation 359
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:746283375"
variation 360
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2482203724"
variation 362..364
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1388017290"
variation 368
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:781388497"
variation 369
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751218204"
variation 370
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406983239"
variation 375
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391243960"
variation 376..382
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tca"
/replace="tcagtca"
/db_xref="dbSNP:762598205"
variation 376
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="t"
/db_xref="dbSNP:2482202996"
variation 376
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1561685621"
variation 377
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:777349763"
variation 378
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:185445391"
variation 379
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425260470"
variation 382
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2482202239"
variation 383
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:749780402"
variation 384
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750057694"
variation 386
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1477188242"
variation 387
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750056781"
variation 389
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750056286"
variation 390..396
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaaa"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/db_xref="dbSNP:750256768"
variation 390
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2482201578"
variation 392
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:377608156"
variation 396
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:549718297"
variation 397
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="c"
/db_xref="dbSNP:2482200959"
variation 397
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750053838"
variation 398
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:759373577"
variation 399
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753728671"
variation 400
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2482200387"
variation 402
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561685364"
variation 405
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1693238677"
exon 406..452
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 408
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438182467"
variation 409
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481919409"
variation 411
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:557986609"
variation 413
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:764452510"
variation 415
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:763064949"
variation 416
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1483041739"
variation 417
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212552"
variation 419
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481919058"
variation 420
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212077"
variation 421..422
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:1403653612"
variation 421..422
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:2481918875"
variation 422
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481918829"
variation 423
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481918784"
variation 425
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765236390"
variation 426
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:548653305"
variation 427
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481918525"
variation 428
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:771385648"
variation 429
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1286587676"
variation 431
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:138507676"
variation 433
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2481918328"
variation 435
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314951065"
variation 436
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:974580309"
variation 438
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481918154"
variation 439
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773540586"
variation 441..442
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1581021207"
variation 442
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2150453321"
variation 443
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481917918"
variation 444
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481917859"
variation 445..451
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaga"
/replace="aagaaga"
/db_xref="dbSNP:2481917502"
variation 446
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581021175"
variation 447
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481917735"
variation 448..449
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:779363914"
variation 448..449
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1748205064"
variation 449
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228585329"
variation 452
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2481917449"
exon 453..535
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 455
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393117032"
variation 458
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180206825"
variation 459
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2481617877"
variation 463
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481617800"
variation 464
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150375703"
variation 467
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481617657"
variation 468
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773628734"
variation 469..472
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aaga"
/db_xref="dbSNP:2481617512"
variation 472
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1237140365"
variation 481
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232231851"
variation 482
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481617223"
variation 483
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1193606113"
variation 484
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745284481"
variation 485
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:547550705"
variation 486
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745283514"
variation 487
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481616836"
variation 488
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1186908669"
variation 489
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481616644"
variation 492
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748490924"
variation 493
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773901255"
variation 495
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481616401"
variation 496
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150375557"
variation 497
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481616200"
variation 502
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:768317556"
variation 503
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1561634678"
variation 505
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748850005"
variation 507
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481615918"
variation 508
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745280061"
variation 509
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:145897680"
variation 510
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:753691260"
variation 513
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481615678"
variation 515
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376463567"
variation 516
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1327050486"
variation 518..524
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaaggaa"
/db_xref="dbSNP:2481615261"
variation 518..521
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aaag"
/db_xref="dbSNP:2150375437"
variation 519
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2481615464"
variation 523
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:140748564"
variation 525
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1286143770"
variation 526
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1745276214"
variation 527
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:745797201"
variation 528
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302333711"
variation 530..535
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ag"
/replace="agaaag"
/db_xref="dbSNP:2481614489"
variation 530
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434037126"
variation 531
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2481614740"
variation 532
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580930674"
variation 533
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:909927578"
variation 535
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481614420"
exon 536..634
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 537
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481609783"
variation 538
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745248317"
variation 539
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195109001"
variation 540
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745247359"
variation 542
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:185309293"
variation 543..544
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="tg"
/db_xref="dbSNP:2481609388"
variation 543
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755218264"
variation 544
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:138940796"
variation 545
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481609268"
variation 546
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481609207"
variation 547
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481609138"
variation 549
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1745244701"
variation 551
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357350104"
variation 552
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265044045"
variation 553
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:892129867"
variation 554
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561633837"
variation 555
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:867891240"
variation 555
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1745242213"
variation 556
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:780195488"
variation 557..588
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ac"
/replace="acagcaacagataatggaatctcttaatgtac"
/db_xref="dbSNP:1745237533"
variation 563
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157077028"
variation 566
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1363410017"
variation 573
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481608474"
variation 574..575
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:2481608348"
variation 574
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2481608406"
variation 575
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756212865"
variation 577
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2481608213"
variation 578
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:750466231"
variation 580
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481608078"
variation 582
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1325715984"
variation 583
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481607941"
variation 584
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481607884"
variation 585
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:767952170"
variation 587
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406824741"
variation 588
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580929057"
variation 590
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:150254661"
variation 591
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481607505"
variation 592
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:2481607435"
variation 592
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1451415236"
variation 593
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745235605"
variation 594
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580928949"
variation 595..596
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="a"
/db_xref="dbSNP:749771436"
variation 595
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:751927567"
variation 596
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:141033147"
variation 601
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:775303734"
variation 602
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481606883"
variation 602
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1471995857"
variation 608
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425234534"
variation 610
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323742457"
variation 611
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2481606672"
variation 612
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745230797"
variation 616
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:540839130"
variation 617
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745229775"
variation 620
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1745229292"
variation 621
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475383930"
variation 625
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1240814809"
variation 626
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1201507225"
variation 627
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452590609"
variation 629
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481606062"
variation 630
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2481606001"
variation 631
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:199710596"
variation 632
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:776182305"
variation 633
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:770828450"
exon 635..761
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 637
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2481593985"
variation 638
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745162523"
variation 639
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481593881"
variation 641
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1192069105"
variation 646
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481593753"
variation 647
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481593696"
variation 654
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745161624"
variation 656..657
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ta"
/db_xref="dbSNP:2481593581"
variation 657..660
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1238965408"
variation 657
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481593525"
variation 659
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745161152"
variation 660
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:752112029"
variation 664
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1203948509"
variation 666
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150372287"
variation 669
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745159363"
variation 671..674
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2481592950"
variation 672
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745158892"
variation 675
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="g"
/db_xref="dbSNP:2481592873"
variation 675
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:764451391"
variation 676
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:758865586"
variation 677
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:753079695"
variation 679
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481592557"
variation 681
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:765028924"
variation 683
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:376864120"
variation 684
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481592271"
variation 686
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481592196"
variation 690
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481592136"
variation 692
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745154105"
variation 693
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481592014"
variation 695..697
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gag"
/db_xref="dbSNP:1231746887"
variation 695
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216777810"
variation 696
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745152720"
variation 697
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481591749"
variation 700
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378696125"
variation 701
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481591622"
variation 707
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:538146502"
variation 708
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868259372"
variation 710
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745150168"
variation 712
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481591302"
variation 713
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1745149712"
variation 714
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:765914401"
variation 715
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1185768219"
variation 718
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:569355500"
variation 719
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377239133"
variation 720
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773227049"
variation 722
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745146291"
variation 723
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745145818"
variation 725..728
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:2481590547"
variation 725
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172188810"
variation 729
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:866918568"
variation 730
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:771962047"
variation 732
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774114264"
variation 734
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1176885832"
variation 735
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468783521"
variation 736
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481590122"
variation 740
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:770061194"
variation 742
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:151068525"
variation 745
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:781204320"
variation 746
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:759021447"
variation 747
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481589729"
variation 749
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481589663"
variation 750..754
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aaaaa"
/db_xref="dbSNP:2481589551"
variation 750..754
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1284629517"
variation 752
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745140405"
variation 756..760
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1745137975"
variation 756
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757372616"
variation 758
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481589378"
variation 760
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481589220"
variation 761
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1409007703"
exon 762..815
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 762
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213991862"
variation 763..773
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaaacattcaa"
/db_xref="dbSNP:1743744485"
variation 766
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:774200181"
variation 768
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1270744844"
variation 769
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561615890"
variation 771
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219885542"
variation 774
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2481414321"
variation 775
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308635150"
variation 776
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481414150"
variation 779
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2481414055"
variation 781
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="c"
/db_xref="dbSNP:2481413989"
variation 781
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:759382373"
variation 792
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:776934831"
variation 793
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1580880398"
variation 795
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2481413591"
variation 797
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:376455824"
variation 800
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743741013"
variation 802
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:747162578"
variation 806
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481413358"
variation 807
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1743739935"
variation 808
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481413216"
variation 809
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440453004"
variation 812
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2481412997"
variation 813
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2481412912"
variation 815
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777984796"
exon 816..1125
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 816
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742872861"
variation 819..820
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="attg"
/db_xref="dbSNP:1742872594"
variation 821
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1203416589"
variation 825
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742872086"
variation 827
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1257754270"
variation 828
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742871795"
variation 830
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742871636"
variation 831
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264537272"
variation 833
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:902115556"
variation 837
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:141113449"
variation 839
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:984915490"
variation 845..853
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tg"
/replace="tgatacatg"
/db_xref="dbSNP:771968649"
variation 849
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1742870816"
variation 851
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:969146943"
variation 854
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:541635390"
variation 855
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023363430"
variation 856
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1482647643"
variation 866
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013697433"
variation 872
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040536560"
variation 873
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377557125"
variation 877
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742868685"
variation 879..882
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="atta"
/replace="attaatta"
/db_xref="dbSNP:1742868212"
variation 879
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742868478"
variation 882
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1235330525"
variation 886
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742867726"
variation 889
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1170023693"
variation 891
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150323462"
variation 892
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742867290"
variation 893
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561604899"
variation 895
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150323454"
variation 896
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742866782"
variation 903
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1561604890"
variation 905
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742866463"
variation 909
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1395566343"
variation 922..928
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ttttaat"
/db_xref="dbSNP:1742866145"
variation 930
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1742865928"
variation 931
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742865718"
variation 932
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:960415421"
variation 933
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1742865286"
variation 937
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1742865081"
variation 941
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1580855888"
variation 942
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1031047258"
variation 943..948
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aat"
/replace="aataat"
/db_xref="dbSNP:1290075532"
variation 944
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1008170348"
variation 947
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:889188814"
variation 949
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1359261220"
variation 951
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742863572"
variation 952
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1044233351"
variation 953
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:999452530"
variation 955
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2150323388"
variation 959
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742863025"
variation 961
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1742862888"
variation 964
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:946829262"
variation 965
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1235494043"
variation 967..968
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ga"
/db_xref="dbSNP:1216623225"
variation 967
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1742862413"
variation 968
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1257158346"
variation 969
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580855772"
variation 971
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1742861660"
variation 972
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150323357"
variation 978
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742861452"
variation 979
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1271684867"
variation 981
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:528233561"
variation 982
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1006710585"
variation 983
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382782475"
variation 985
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742860359"
variation 988
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742860172"
variation 992..993
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1378546432"
variation 992
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1742859963"
variation 998
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742859548"
variation 999
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:889228983"
variation 1005
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150323315"
variation 1007
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150323309"
variation 1015
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1334864048"
variation 1016
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1050547626"
variation 1017
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742858629"
variation 1018
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742858329"
variation 1021..1022
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="at"
/db_xref="dbSNP:1407159826"
variation 1024
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:750194911"
variation 1025
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742856967"
variation 1032
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331066642"
variation 1037
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2150323266"
variation 1038
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1418807232"
variation 1039
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481300517"
variation 1043
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742856286"
variation 1044
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:559228580"
variation 1053
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1561604774"
variation 1057
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:184796610"
variation 1058
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:73762017"
variation 1061
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1742854506"
variation 1067
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742854285"
variation 1068
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:182011671"
variation 1074
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1401152017"
variation 1076
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2481300330"
variation 1077
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:940981001"
variation 1082
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580855574"
variation 1083
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:549176228"
variation 1084
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1423805760"
variation 1085
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742852727"
variation 1087
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150323187"
variation 1093
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742852508"
variation 1101..1104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="taac"
/db_xref="dbSNP:1742852298"
variation 1101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2481300201"
regulatory 1106..1111
/regulatory_class="polyA_signal_sequence"
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="hexamer: AATATA"
variation 1109
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:114119671"
variation 1110
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:748849777"
variation 1115
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:753526956"
variation 1116
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1356918026"
variation 1119
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1412569901"
variation 1121
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:970332536"
variation 1123
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742850695"
polyA_site 1125
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="major polyA site"
ORIGIN
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccaggttacatacagcttacatcttgcatcctcaagcggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagaggtcctctctgccttggggtaaccactatttgatacatgctattatttttcatgttacgttatgattattctcttccatcatttgactgtgtccagaagatcatccattttaatgaatcttgttttgcaataatcagagagccaattcacatgatggtggattgttcgtatctgtttaatcctggtaagagagcagagacaatggaattgtacaagatgctggattaaacttagagaaggcagaaaagtggaagacaagaacaaaagatcgattaatagaaaacattaacaaatatagtaatttatatcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]