ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-18 21:35:24, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001317123 13617 bp mRNA linear PRI 19-NOV-2023 DEFINITION Homo sapiens argonaute RISC component 1 (AGO1), transcript variant 2, mRNA. ACCESSION NM_001317123 XM_011541238 VERSION NM_001317123.2 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 13617) AUTHORS Fang X, Ren LH, Shrestha SM, Ji Q, Xu Z, Wang D, Ding Q, Liang X and Shi RH. TITLE LINC01116 modulates EMT process via binding with AGO1 mRNA in oesophageal squamous cell carcinoma JOURNAL Biochim Biophys Acta Mol Cell Res 1870 (5), 119447 (2023) PUBMED 36990227 REMARK GeneRIF: LINC01116 modulates EMT process via binding with AGO1 mRNA in oesophageal squamous cell carcinoma. REFERENCE 2 (bases 1 to 13617) AUTHORS Schalk A, Cousin MA, Dsouza NR, Challman TD, Wain KE, Powis Z, Minks K, Trimouille A, Lasseaux E, Lacombe D, Angelini C, Michaud V, Van-Gils J, Spataro N, Ruiz A, Gabau E, Stolerman E, Washington C, Louie R, Lanpher BC, Kemppainen JL, Innes M, Kooy F, Meuwissen M, Goldenberg A, Lecoquierre F, Vera G, Diderich KEM, Sheidley B, El Achkar CM, Park M, Hamdan FF, Michaud JL, Lewis AJ, Zweier C, Reis A, Wagner M, Weigand H, Journel H, Keren B, Passemard S, Mignot C, van Gassen K, Brilstra EH, Itzikowitz G, O'Heir E, Allen J, Donald KA, Korf BR, Skelton T, Thompson M, Robin NH, Rudy NL, Dobyns WB, Foss K, Zarate YA, Bosanko KA, Alembik Y, Durand B, Tran Mau-Them F, Ranza E, Blanc X, Antonarakis SE, McWalter K, Torti E, Millan F, Dameron A, Tokita M, Zimmermann MT, Klee EW, Piton A and Gerard B. TITLE De novo coding variants in the AGO1 gene cause a neurodevelopmental disorder with intellectual disability JOURNAL J Med Genet 59 (10), 965-975 (2022) PUBMED 34930816 REMARK GeneRIF: De novo coding variants in the AGO1 gene cause a neurodevelopmental disorder with intellectual disability. REFERENCE 3 (bases 1 to 13617) AUTHORS Kowalczyk M, Kowalczyk E, Galita G, Majsterek I, Talarowska M, Poplawski T, Kwiatkowski P, Lichota A and Sienkiewicz M. TITLE Association of Polymorphic Variants in Argonaute Genes with Depression Risk in a Polish Population JOURNAL Int J Mol Sci 23 (18), 10586 (2022) PUBMED 36142498 REMARK GeneRIF: Association of Polymorphic Variants in Argonaute Genes with Depression Risk in a Polish Population. Publication Status: Online-Only REFERENCE 4 (bases 1 to 13617) AUTHORS Niu Y, Qian Q, Li J, Gong P, Jiao X, Mao X, Xiao B, Long L and Yang Z. TITLE De novo variants in AGO1 recapitulate a heterogeneous neurodevelopmental disorder phenotype JOURNAL Clin Genet 101 (4), 459-465 (2022) PUBMED 35060114 REMARK GeneRIF: De novo variants in AGO1 recapitulate a heterogeneous neurodevelopmental disorder phenotype. REFERENCE 5 (bases 1 to 13617) AUTHORS Eswarappa SM, Potdar AA, Koch WJ, Fan Y, Vasu K, Lindner D, Willard B, Graham LM, DiCorleto PE and Fox PL. TITLE Programmed translational readthrough generates antiangiogenic VEGF-Ax JOURNAL Cell 157 (7), 1605-1618 (2014) PUBMED 24949972 REFERENCE 6 (bases 1 to 13617) AUTHORS Carmell MA, Xuan Z, Zhang MQ and Hannon GJ. TITLE The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis JOURNAL Genes Dev 16 (21), 2733-2742 (2002) PUBMED 12414724 REMARK Review article REFERENCE 7 (bases 1 to 13617) AUTHORS Martinez J, Patkaniowska A, Urlaub H, Luhrmann R and Tuschl T. TITLE Single-stranded antisense siRNAs guide target RNA cleavage in RNAi JOURNAL Cell 110 (5), 563-574 (2002) PUBMED 12230974 REFERENCE 8 (bases 1 to 13617) AUTHORS Beier H and Grimm M. TITLE Misreading of termination codons in eukaryotes by natural nonsense suppressor tRNAs JOURNAL Nucleic Acids Res 29 (23), 4767-4782 (2001) PUBMED 11726686 REMARK Review article REFERENCE 9 (bases 1 to 13617) AUTHORS Koesters R, Adams V, Betts D, Moos R, Schmid M, Siermann A, Hassam S, Weitz S, Lichter P, Heitz PU, von Knebel Doeberitz M and Briner J. TITLE Human eukaryotic initiation factor EIF2C1 gene: cDNA sequence, genomic organization, localization to chromosomal bands 1p34-p35, and expression JOURNAL Genomics 61 (2), 210-218 (1999) PUBMED 10534406 REFERENCE 10 (bases 1 to 13617) AUTHORS Reddy PH, Stockburger E, Gillevet P and Tagle DA. TITLE Mapping and characterization of novel (CAG)n repeat cDNAs from adult human brain derived by the oligo capture method JOURNAL Genomics 46 (2), 174-182 (1997) PUBMED 9417904 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL139286.13, AK001622.1, AK314148.1, AF093097.1 and CR936823.1. On Aug 13, 2020 this sequence version replaced NM_001317123.1. Summary: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]. Transcript Variant: This variant (2) contains an alternate 5' terminal exon, which results in translation initiation from an in-frame, downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR14038191.1159841.1, AK001622.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148093 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-47 AL139286.13 128233-128279 c 48-1838 AK001622.1 1-1791 1839-2692 AK314148.1 1909-2762 2693-7383 AF093097.1 2788-7478 7384-7384 CR936823.1 6081-6081 7385-13617 AL139286.13 67508-73740 c FEATURES Location/Qualifiers source 1..13617 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1p34.3" gene 1..13617 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /note="argonaute RISC component 1" /db_xref="GeneID:26523" /db_xref="HGNC:HGNC:3262" /db_xref="MIM:606228" exon 1..143 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /inference="alignment:Splign:2.1.0" variation 2 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1385825092" variation 4 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1404666401" variation 7 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:1644930770" variation 11 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1644930786" variation 12 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:998244815" variation 13 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1028239833" variation 14 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:954052138" variation 16 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1644930858" variation 20 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1644930876" variation 23 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1297611178" variation 24 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1005871917" variation 25 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1644930929" variation 26..29 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="cgcc" /db_xref="dbSNP:1644930943" variation 27..45 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="gccacgtgagagggaagcc" /replace="gccacgtgagagggaagccacgtgagagggaagcc" /db_xref="dbSNP:1553152025" variation 27 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1016888920" variation 28..29 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="cc" /db_xref="dbSNP:1644931682" variation 31 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1346142965" variation 35 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1441292721" variation 38 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:995885903" variation 39 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1030122462" variation 41 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1644931778" variation 43 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:527841512" variation 44 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:745464538" variation 45 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:954607501" variation 46..77 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="cgtgaggc" /replace="cgtgaggcaagcgcctcaggagtgcgtgaggc" /replace="cgtgaggcaagcgcctcaggagtgcgtgaggcaagcgcctcaggagtg cgtgaggc" /db_xref="dbSNP:1396888493" variation 46 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:983335258" variation 47 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1279607868" variation 48 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1383518370" variation 49 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:972620153" variation 51 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:369900181" variation 54 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:1557595488" variation 55 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1644932012" variation 57 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1644932021" variation 58 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1644932032" variation 59..83 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="" /replace="cctcaggagtgcgtgaggcccacgc" /db_xref="dbSNP:1438164351" variation 59 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1306252075" variation 60 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:971111345" variation 62 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1238961258" variation 69 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1644932634" variation 70 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1271766622" variation 74 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:1644932671" variation 76 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1470230105" variation 78 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1644932700" variation 80..88 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="ac" /replace="acgcagaac" /db_xref="dbSNP:558839033" variation 81 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1353312396" variation 82 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1209575320" variation 83..88 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="cagaac" /db_xref="dbSNP:766085707" variation 83 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1644932778" variation 84 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:776441735" variation 85 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:926938900" variation 87 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1644932850" variation 88 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1238014452" variation 89 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1644932886" variation 91..94 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="ggg" /replace="gggg" /db_xref="dbSNP:1467193009" variation 91 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:935720081" variation 96 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1253720949" variation 103 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1571329117" variation 104 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:1644932969" variation 105 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:1433636370" variation 106 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1644933006" misc_feature 107..109 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /note="upstream in-frame stop codon" variation 110 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1644933023" variation 113 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1181038083" variation 115 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:759056711" variation 116..117 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="" /replace="ag" /db_xref="dbSNP:1644933097" variation 116 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1054428282" variation 117..120 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="ggg" /replace="gggg" /db_xref="dbSNP:948738033" variation 118 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1184300416" variation 120 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1393347718" variation 123 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1644933244" variation 125 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1644933255" variation 126 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:151091576" variation 128 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:542200905" variation 129 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1367727299" variation 134 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1042512783" variation 136 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:901354229" variation 137..140 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="tatt" /replace="tattatt" /db_xref="dbSNP:1305561337" variation 141 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:998189092" variation 142 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1049832802" exon 144..327 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /inference="alignment:Splign:2.1.0" variation 144 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:534382148" variation 146 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:12746607" variation 147 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:146814747" variation 148 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:972036410" variation 150 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:144077445" variation 151 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:140869088" variation 152 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1170596078" variation 153 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645155622" variation 160 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1340212230" variation 161..167 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="ccccccc" /replace="cccccccc" /db_xref="dbSNP:752471592" variation 163 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645155750" variation 164 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1206703390" variation 165 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:760951179" variation 166 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:202083240" variation 167 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1557603507" variation 168 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:2148708759" variation 169 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:138410930" variation 171 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:757285327" variation 174 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:1022788713" variation 175 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1240989789" variation 176 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1446100175" variation 177 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1571342863" variation 178 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:79428335" variation 179 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:75289061" variation 180 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1645156392" variation 181 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:76388453" variation 184 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645156505" variation 186 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645156570" variation 189 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645156617" variation 191 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:779432389" variation 192 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1258716583" variation 193 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1163754955" variation 194 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645156991" variation 195 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1389168609" variation 202 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1424891938" variation 203 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:750911996" variation 205 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:968257736" variation 210 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:758952997" variation 212 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1355653345" variation 213 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1262459523" variation 214 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:574337653" variation 218 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645157658" variation 220 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1179019303" variation 221 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1335156626" variation 224 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:747438396" variation 226 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1385353517" variation 230 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1645157898" variation 232 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1418697160" variation 239 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1179971147" variation 240 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:926553379" variation 244 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:768283757" variation 252 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1297216732" variation 254 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:199891800" variation 259 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1337673800" variation 261 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:868103064" variation 266 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:146957455" variation 268 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:200988923" variation 269 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:773153331" variation 271 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:762965113" variation 283 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:143228790" variation 293 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1286109881" variation 295 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645158647" variation 299 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1347111293" variation 300 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1448364494" variation 301 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:74665168" variation 302 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:764307761" variation 303 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:1042059854" variation 305 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645159128" variation 306 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:1645159199" variation 313 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1321314626" variation 317 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:200676269" variation 318 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645159446" variation 321 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1251930499" variation 322 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:564776109" variation 324 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1194249910" variation 325 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:375999904" exon 328..448 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /inference="alignment:Splign:2.1.0" variation 331 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:755840915" variation 334 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1039211966" variation 343 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645239978" CDS 344..2692 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /note="isoform 2 is encoded by transcript variant 2; Golgi Endoplasmic Reticulum protein 95 kDa; putative RNA-binding protein Q99; protein argonaute-1; eIF2C 1; eIF-2C 1; argonaute1; eukaryotic translation initiation factor 2C, 1; argonaute 1, RISC catalytic component; argonaute RISC catalytic component 1" /codon_start=1 /product="protein argonaute-1 isoform 2" /protein_id="NP_001304052.1" /db_xref="CCDS:CCDS81300.1" /db_xref="GeneID:26523" /db_xref="HGNC:HGNC:3262" /db_xref="MIM:606228" /translation="
MVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
misc_feature 386..610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:435368"
misc_feature 638..790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:430160"
misc_feature 791..1153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(947..949,992..994,1034..1036,1046..1048,1100..1102,
1121..1123,1127..1129)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 1286..2563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1697..1699,1709..1711,1745..1756,1763..1765,
1787..1789,1796..1798,1808..1810,1820..1822)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(1901..1903,1907..1909,2117..2119,2531..2533)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="active site"
/db_xref="CDD:240015"
variation 344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777119725"
variation 351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1355230423"
variation 352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645240094"
variation 353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748876689"
variation 355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294130512"
variation 365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645240210"
variation 367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770982492"
variation 380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774432228"
variation 381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:745615692"
variation 391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645240476"
variation 405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148710841"
variation 412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487074387"
variation 418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187568812"
variation 423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:368596181"
variation 425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1373509253"
variation 426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:998200306"
variation 427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771782526"
variation 430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:775400690"
variation 434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645243206"
variation 442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:761909595"
variation 443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:371043471"
variation 447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:773265965"
exon 449..630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1037229267"
variation 452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766471361"
variation 453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:867858441"
variation 454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645251826"
variation 460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1479111626"
variation 461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645251932"
variation 464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645251969"
variation 466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:774463509"
variation 467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645252076"
variation 469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1306694761"
variation 473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557606462"
variation 488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1327559774"
variation 496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759929800"
variation 505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645252397"
variation 506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557606472"
variation 511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:768140024"
variation 518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645252575"
variation 521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:974811600"
variation 534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:748561732"
variation 537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:756518480"
variation 538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763796047"
variation 547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645252872"
variation 548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645252917"
variation 550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140048484"
variation 551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406926679"
variation 553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:778531571"
variation 556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750019410"
variation 559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551846586"
variation 560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780052272"
variation 565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1295434292"
variation 566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1044509129"
variation 568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645253450"
variation 569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:746713624"
variation 572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1356391187"
variation 575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645253604"
variation 576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768528277"
variation 577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:777924524"
variation 578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1348951466"
variation 579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1225740432"
variation 583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146336392"
variation 587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398998653"
variation 589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771183369"
variation 590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645254066"
variation 591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774413049"
variation 593
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1275859576"
variation 594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275269608"
variation 598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645254286"
variation 602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645254328"
variation 604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000221753"
variation 608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759723959"
variation 611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1298655751"
variation 612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645254551"
variation 613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204721590"
variation 616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1250637242"
variation 617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481913947"
variation 620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200107860"
variation 625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772403603"
exon 631..767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757928895"
variation 638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148711333"
variation 640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339623786"
variation 646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935986859"
variation 647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:369913779"
variation 652..659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cttct"
/replace="cttcttct"
/db_xref="dbSNP:1553154062"
variation 654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450839608"
variation 655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557606960"
variation 661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1216160432"
variation 663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196584082"
variation 664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:923359271"
variation 669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1243777480"
variation 670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1054485245"
variation 681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571348661"
variation 682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:751539508"
variation 684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1553154069"
variation 685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:754921891"
variation 687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645264815"
variation 691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645264900"
variation 694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571348686"
variation 699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1388452609"
variation 700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645265183"
variation 701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711374"
variation 702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780934730"
variation 705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:745945344"
variation 709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148711380"
variation 713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711383"
variation 721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390406046"
variation 726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645265474"
variation 732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1385468503"
variation 740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557607042"
variation 762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1415969084"
variation 763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320779237"
variation 766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645265786"
exon 768..902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:11806527"
variation 775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:11811275"
variation 785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:751072190"
variation 786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281040808"
variation 787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645271909"
variation 793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299243666"
variation 798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754906190"
variation 799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2296470"
variation 804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645272259"
variation 809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571349090"
variation 812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266180488"
variation 813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372933409"
variation 816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1204384593"
variation 818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255631567"
variation 820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:201138355"
variation 823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184303864"
variation 830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645272758"
variation 832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1364687783"
variation 837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778966083"
variation 838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645272959"
variation 842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:17855789"
variation 844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758584590"
variation 847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362228512"
variation 851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273227"
variation 853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1010672520"
variation 857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1422475379"
variation 859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645273440"
variation 860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018151324"
variation 862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273614"
variation 864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470621142"
variation 865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:780175783"
variation 866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1400919651"
variation 870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273887"
variation 876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645273962"
variation 877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747113992"
variation 878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645274152"
variation 883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:769226315"
variation 892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350821626"
exon 903..990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:770562881"
variation 904..905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:34232554"
variation 905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645278321"
variation 910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645278406"
variation 915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:773882882"
variation 919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191695845"
variation 922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1428675136"
variation 925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1166366490"
variation 933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645278705"
variation 936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759010563"
variation 949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372555392"
variation 950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645278907"
variation 952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759416843"
variation 953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:533050841"
variation 955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292791760"
variation 957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711775"
variation 959..960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:2148711782"
variation 959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1162477236"
variation 961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760596663"
variation 964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551240186"
variation 965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571349540"
variation 967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:570547124"
variation 968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645279527"
variation 971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645279588"
variation 973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571349563"
variation 974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571349566"
variation 976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1364584684"
variation 977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:761517181"
variation 980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645279945"
variation 990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294234936"
exon 991..1138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 991..1046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="att"
/replace="attccccttacagctggagagtggacagactgtggagtgcacagtggc
acagtatt"
/db_xref="dbSNP:1557608209"
variation 991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753991581"
variation 994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645296230"
variation 996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1295256848"
variation 997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:189586551"
variation 1008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051022486"
variation 1012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238748148"
variation 1020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472903106"
variation 1021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:372979737"
variation 1025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148712287"
variation 1029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296616"
variation 1031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1306020581"
variation 1036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296748"
variation 1041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296815"
variation 1051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050283350"
variation 1060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546553880"
variation 1061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420666776"
variation 1066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645297028"
variation 1071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757631001"
variation 1081
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909137877"
variation 1082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411142617"
variation 1087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645297285"
variation 1093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756155452"
variation 1094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338758069"
variation 1105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645297454"
variation 1109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759454083"
variation 1117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359860901"
variation 1126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447524690"
variation 1129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778306053"
variation 1132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:149082767"
variation 1133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:151208943"
exon 1139..1258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275974433"
variation 1145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148715329"
variation 1147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:775889960"
variation 1148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200563862"
variation 1149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557612017"
variation 1154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1415960544"
variation 1160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:764062753"
variation 1162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050570393"
variation 1163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:908985871"
variation 1164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148715349"
variation 1168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416045"
variation 1173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1343816827"
variation 1174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753994302"
variation 1182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278173586"
variation 1183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:757689155"
variation 1188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645416400"
variation 1189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416455"
variation 1197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416507"
variation 1198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:199616208"
variation 1201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1200825557"
variation 1225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758791735"
variation 1229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715372"
variation 1234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779631833"
variation 1237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645416806"
variation 1239..1246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggag"
/replace="aggaggag"
/db_xref="dbSNP:2148715376"
variation 1241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:762638025"
variation 1243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:746619529"
variation 1245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1430592479"
variation 1249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1168233985"
variation 1251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1369030058"
variation 1253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:754699172"
variation 1255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274129921"
variation 1256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:780563736"
exon 1259..1381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750947963"
variation 1265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1404044449"
variation 1266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148715571"
variation 1269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715573"
variation 1272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1320886676"
variation 1275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645424335"
variation 1276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424415"
variation 1278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148715578"
variation 1279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424467"
variation 1286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424528"
variation 1287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758951181"
variation 1291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:72661614"
variation 1294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1296302699"
variation 1297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:752028013"
variation 1300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002104589"
variation 1303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:868287969"
variation 1306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:754573452"
variation 1309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328358090"
variation 1312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542457159"
variation 1317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284524734"
variation 1320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:780911842"
variation 1321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425246"
variation 1322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1226472292"
variation 1325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557612417"
variation 1326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425404"
variation 1328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645425456"
variation 1329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425501"
variation 1330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:747545727"
variation 1335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715621"
variation 1337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:755717690"
variation 1338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425695"
variation 1343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1208181934"
variation 1348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645425811"
variation 1352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571357990"
variation 1353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:376308772"
variation 1354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:377394072"
variation 1356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:544024909"
variation 1357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142094247"
variation 1361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1472015606"
variation 1363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161925549"
variation 1372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:745684571"
variation 1375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:61751003"
variation 1376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:893311782"
variation 1378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645426498"
variation 1379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935068063"
variation 1380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645426594"
exon 1382..1515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645430270"
variation 1385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779760591"
variation 1386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258906885"
variation 1387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645430440"
variation 1390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748337975"
variation 1391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1428424991"
variation 1398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015543488"
variation 1402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:199936275"
variation 1408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773266381"
variation 1414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:763034859"
variation 1415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1432427531"
variation 1420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:771277669"
variation 1421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170126627"
variation 1422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645431243"
variation 1424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148715842"
variation 1426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148715846"
variation 1427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431327"
variation 1428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1370865156"
variation 1429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774954734"
variation 1432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431506"
variation 1435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759771963"
variation 1438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369633288"
variation 1442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431703"
variation 1443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1387317470"
variation 1447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571358401"
variation 1449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313546401"
variation 1453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1300648006"
variation 1458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:371917876"
variation 1460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368914800"
variation 1462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557612737"
variation 1469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753155364"
variation 1471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760403306"
variation 1476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645432313"
variation 1477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:375102195"
variation 1480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645432435"
variation 1481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1262161642"
variation 1482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:753328428"
variation 1489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:919044941"
variation 1500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203451050"
variation 1511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:569514136"
variation 1513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023867293"
exon 1516..1700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199479145"
variation 1525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645532937"
variation 1528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645533022"
variation 1531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:945694295"
variation 1535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:775988217"
variation 1536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761121371"
variation 1537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645533275"
variation 1542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:12739932"
variation 1552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763795877"
variation 1554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148718885"
variation 1555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1184426040"
variation 1562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415613590"
variation 1565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1557615824"
variation 1576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:776441734"
variation 1579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769789947"
variation 1580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1163885953"
variation 1594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040031325"
variation 1597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:12735795"
variation 1599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:12735796"
variation 1600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:368806171"
variation 1604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1167063899"
variation 1610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645534232"
variation 1612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458793259"
variation 1613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998417309"
variation 1618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340285630"
variation 1621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148718923"
variation 1622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1421049999"
variation 1623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645534556"
variation 1625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:201120683"
variation 1626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645534737"
variation 1627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1466906554"
variation 1628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006126627"
variation 1629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1321275499"
variation 1630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:764770945"
variation 1633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:749967453"
variation 1636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758341990"
variation 1638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1341527708"
variation 1643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380272290"
variation 1644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:143395835"
variation 1645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751289476"
variation 1647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:200447801"
variation 1648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754799646"
variation 1649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645535695"
variation 1651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1050019769"
variation 1657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:371346774"
variation 1661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268149326"
variation 1668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645536021"
variation 1672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1401160206"
variation 1681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645536136"
variation 1690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:749491572"
variation 1693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757463904"
exon 1701..1860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645685994"
variation 1712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385910631"
variation 1713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:758585726"
variation 1715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645686189"
variation 1717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:780324190"
variation 1726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645686375"
variation 1729
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723061"
variation 1732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:747499045"
variation 1743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:769346828"
variation 1744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:199790587"
variation 1753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225197236"
variation 1757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301736040"
variation 1758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265127399"
variation 1759..1760
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645686932"
variation 1760..1761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gggaacacaataatgac"
/db_xref="dbSNP:1645687001"
variation 1765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:141975081"
variation 1766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:769429758"
variation 1767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645687220"
variation 1769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300821067"
variation 1770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571373923"
variation 1771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:888769037"
variation 1777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645687499"
variation 1780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645687560"
variation 1781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645687616"
variation 1788..1791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1645687661"
variation 1790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343928483"
variation 1795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723097"
variation 1799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645687783"
variation 1804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1205604565"
variation 1816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:139495925"
variation 1823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645688251"
variation 1828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1038775292"
variation 1832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1432507106"
variation 1841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762483320"
variation 1846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778368573"
variation 1849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1223700131"
variation 1852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247322617"
variation 1859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645688704"
exon 1861..1951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1164256024"
variation 1867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770625415"
variation 1868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528425591"
variation 1870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645692834"
variation 1876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:771935455"
variation 1891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775325449"
variation 1892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645693020"
variation 1900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557621093"
variation 1903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:547329659"
variation 1904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645693235"
variation 1909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:753726639"
variation 1910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645693386"
variation 1912..1917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:35257283"
variation 1912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324407912"
variation 1914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557621129"
variation 1915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150639776"
variation 1916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1284611497"
variation 1918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149707892"
variation 1920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723245"
variation 1921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:751632923"
variation 1930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1270050276"
variation 1933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:568739814"
variation 1938..1942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:551219785"
variation 1941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1353927503"
variation 1942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645694220"
variation 1943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:201807040"
variation 1945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1460339268"
variation 1948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:748183477"
variation 1949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756692838"
exon 1952..2146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 1954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397084516"
variation 1956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:981999787"
variation 1963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390797463"
variation 1965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:756572252"
variation 1968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:754140760"
variation 1969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757637094"
variation 1970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:779294804"
variation 1971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:745501471"
variation 1974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:72661618"
variation 1976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645715386"
variation 1979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715448"
variation 1980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645715524"
variation 1983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715568"
variation 1987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1455593427"
variation 1994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:779428711"
variation 2000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746534916"
variation 2001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571375783"
variation 2004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571375789"
variation 2008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1348772102"
variation 2010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715985"
variation 2011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:776733250"
variation 2012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1177037855"
variation 2014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148723911"
variation 2015
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747913193"
variation 2017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1251138878"
variation 2024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:548570122"
variation 2026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769680596"
variation 2039..2061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tcctacatggtgcgtgagctcct"
/replace="tcctacatggtgcgtgagctcctacatggtgcgtgagctcct"
/db_xref="dbSNP:1553156567"
variation 2041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:148568098"
variation 2045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:759663700"
variation 2049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767845424"
variation 2051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645716713"
variation 2052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452226490"
variation 2056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645716848"
variation 2057
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1170223877"
variation 2059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775362502"
variation 2062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1461384946"
variation 2065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1296384917"
variation 2068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:575591328"
variation 2077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764455703"
variation 2079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645717324"
variation 2080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754370001"
variation 2084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723971"
variation 2085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1369025845"
variation 2096
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762360695"
variation 2097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296692574"
variation 2098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:147571046"
variation 2099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:750855900"
variation 2101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723986"
variation 2102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757924485"
variation 2104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779770428"
variation 2105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267744084"
variation 2107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1165442477"
variation 2108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:750985823"
variation 2114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1213741177"
variation 2115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754547764"
variation 2116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466822711"
variation 2117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645718693"
variation 2122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1190144851"
variation 2123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1262080535"
variation 2125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780890292"
variation 2127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:12564106"
variation 2133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:769908492"
variation 2140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645719049"
variation 2143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645719104"
exon 2147..2281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tttttttt"
/db_xref="dbSNP:1414634162"
variation 2152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756047129"
variation 2154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565958096"
variation 2155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645758202"
variation 2157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1224957910"
variation 2160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:896742034"
variation 2162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1307134258"
variation 2164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:748984548"
variation 2165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:143104504"
variation 2173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645758583"
variation 2176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1282114791"
variation 2182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778610016"
variation 2185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645758802"
variation 2188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1209966112"
variation 2196..2199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148725180"
variation 2200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645758944"
variation 2206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:7512720"
variation 2215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1020631361"
variation 2216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557623594"
variation 2224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768936737"
variation 2228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142277966"
variation 2230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:138262926"
variation 2231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645759563"
variation 2239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770238895"
variation 2240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148725216"
variation 2241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:773801844"
variation 2245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763410885"
variation 2255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:766745148"
variation 2262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1311510365"
variation 2271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774636073"
variation 2279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557623659"
variation 2280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645760176"
variation 2281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759256057"
exon 2282..2383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439738572"
variation 2289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:373512212"
variation 2299
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759990630"
variation 2301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1160280075"
variation 2308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767227187"
variation 2313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645772040"
variation 2315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1272181556"
variation 2317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1305762819"
variation 2318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645772202"
variation 2319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015522007"
variation 2320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1394089472"
variation 2324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438949295"
variation 2325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328128014"
variation 2327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1371847135"
variation 2328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775311574"
variation 2330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:962129831"
variation 2338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278891860"
variation 2339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645772715"
variation 2341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:760440138"
variation 2347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763635186"
variation 2358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645772906"
variation 2360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191993432"
variation 2362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:370393930"
variation 2365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757155977"
variation 2370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148725560"
variation 2371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:765103292"
variation 2372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750172296"
variation 2374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423532922"
exon 2384..2583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:761255422"
variation 2403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557624574"
variation 2407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:765183489"
variation 2409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750331557"
variation 2419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1396473268"
variation 2422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762926752"
variation 2423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400980541"
variation 2425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1309729088"
variation 2427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351503366"
variation 2429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:766150388"
variation 2430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:371456175"
variation 2431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1416482791"
variation 2437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293818805"
variation 2440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148725983"
variation 2443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756293606"
variation 2446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777869344"
variation 2452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:753905238"
variation 2455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1351616919"
variation 2460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148725999"
variation 2461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766341150"
variation 2464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1282516031"
variation 2465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571380407"
variation 2467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:779087158"
variation 2469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645787177"
variation 2482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746352418"
variation 2483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:144290045"
variation 2486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1316031798"
variation 2494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1009486066"
variation 2497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253810168"
variation 2507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148726029"
variation 2509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:780502108"
variation 2513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645787653"
variation 2524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:139104482"
variation 2531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1257568536"
variation 2532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1365053413"
variation 2533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768309604"
variation 2536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645787971"
variation 2539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645788028"
variation 2542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:781573871"
variation 2546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157651125"
variation 2547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557624739"
variation 2551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425163970"
variation 2553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:867363147"
variation 2554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645788386"
variation 2561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:776181658"
variation 2563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1372029994"
variation 2569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1436350986"
variation 2575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571380526"
variation 2576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1318627286"
variation 2581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645788766"
exon 2584..13617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/inference="alignment:Splign:2.1.0"
variation 2584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571380871"
variation 2600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200112017"
variation 2604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747745215"
variation 2605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537312381"
variation 2613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:772641687"
variation 2617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645794818"
variation 2622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1230155462"
variation 2623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645794950"
variation 2634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1252403207"
variation 2635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1339352983"
variation 2641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:748808273"
variation 2647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:367549238"
variation 2648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314564307"
variation 2651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:774302590"
variation 2654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759554925"
variation 2669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:371427797"
variation 2675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1009951542"
variation 2677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:778473881"
variation 2686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:764523718"
variation 2687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:775410850"
variation 2689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:761934070"
variation 2695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:765573016"
variation 2701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:750483408"
variation 2702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645796023"
variation 2703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645796066"
variation 2706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:758585810"
variation 2710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766609131"
variation 2711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1325491422"
variation 2712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1365840620"
variation 2714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:751988702"
variation 2717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:755567551"
variation 2721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1415466187"
variation 2725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645796465"
variation 2727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399336214"
variation 2733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645796571"
variation 2737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:376748083"
variation 2738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217374400"
variation 2740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343703234"
variation 2742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:748552081"
variation 2748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:965243292"
variation 2749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:745575440"
variation 2751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438723139"
variation 2753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645796975"
variation 2754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:558595376"
variation 2762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1369626433"
variation 2770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797129"
variation 2776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219639480"
variation 2779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645797215"
variation 2782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797274"
variation 2787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381154"
variation 2788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797336"
variation 2792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381165"
variation 2796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797421"
variation 2802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797468"
variation 2804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1321542247"
variation 2805..2821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggatgccttgtttcct"
/replace="aggatgccttgtttcctaaggatgccttgtttcct"
/db_xref="dbSNP:1645797586"
variation 2806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283260848"
variation 2807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797684"
variation 2810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797727"
variation 2814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:953916295"
variation 2815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797820"
variation 2818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645797860"
variation 2819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571381191"
variation 2820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571381199"
variation 2822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645798304"
variation 2823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314872898"
variation 2825
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:983883552"
variation 2830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:879239347"
variation 2831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645798493"
variation 2833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:150023314"
variation 2835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381230"
variation 2836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:909582929"
variation 2837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1025410190"
variation 2842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759347470"
variation 2843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381248"
variation 2844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1211269541"
variation 2845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1485412027"
variation 2851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:972780830"
variation 2862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645799010"
variation 2863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1478628272"
variation 2868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:372514513"
variation 2875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1406280799"
variation 2882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645799213"
variation 2883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645799270"
variation 2890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645799367"
variation 2890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184496486"
variation 2892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1031125362"
variation 2900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1160196944"
variation 2903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645799508"
variation 2904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:958110614"
variation 2905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:949596040"
variation 2908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1263585743"
variation 2909..2912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1645799907"
variation 2909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:989617377"
variation 2912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1351587097"
variation 2913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982388540"
variation 2914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645800054"
variation 2915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571381367"
variation 2916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381375"
variation 2918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1278837312"
variation 2920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1348418143"
variation 2928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:541172177"
variation 2938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571381393"
variation 2941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645800369"
variation 2943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:202115790"
variation 2945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1288662217"
variation 2947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645800533"
variation 2950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645800586"
variation 2951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571381418"
variation 2952..2953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:878964846"
variation 2958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:911352318"
variation 2963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426560286"
variation 2965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181957464"
variation 2974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645800907"
variation 2976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645800952"
variation 2981..2987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="acaca"
/replace="acacaca"
/db_xref="dbSNP:977058838"
variation 2985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:922824952"
variation 2989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148726405"
variation 2991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360308850"
variation 2996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645801187"
variation 2997..3010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtgactcacagtg"
/db_xref="dbSNP:1645801236"
variation 2998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1183336786"
variation 3002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:938140807"
variation 3006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:187653963"
variation 3007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571381510"
variation 3008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645801465"
variation 3011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1474331605"
variation 3013..3015
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:2148726435"
variation 3013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541984369"
variation 3017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:563307920"
variation 3024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1400788229"
variation 3027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:530845732"
variation 3029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645801740"
variation 3035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:545735322"
variation 3036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1042351647"
variation 3039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1411490768"
variation 3041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645801948"
variation 3045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645801989"
variation 3046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760505499"
variation 3051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343689135"
variation 3055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1055654359"
variation 3056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802314"
variation 3061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:901211923"
variation 3064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1225506641"
variation 3068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:894285520"
variation 3069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802528"
variation 3072
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285541494"
variation 3073..3074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645802682"
variation 3073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802635"
variation 3079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381598"
variation 3082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726466"
variation 3085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645802788"
variation 3087..3098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gat"
/replace="gatactttagat"
/db_xref="dbSNP:1645802823"
variation 3094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1644547952"
variation 3096
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645802872"
variation 3099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645802921"
variation 3102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564987081"
variation 3104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:949852940"
variation 3116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213406425"
variation 3117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1273180555"
variation 3119..3121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1645803165"
variation 3124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045673538"
variation 3125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1206364733"
variation 3126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645803305"
variation 3127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:903096962"
variation 3128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1484869602"
variation 3129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998051016"
variation 3133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645803490"
variation 3135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:190778316"
variation 3136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028235058"
variation 3140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:573515805"
variation 3143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:999569691"
variation 3164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1166214313"
variation 3165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726515"
variation 3167..3174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="aggactag"
/db_xref="dbSNP:542709440"
variation 3169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:889712007"
variation 3176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645803888"
variation 3177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1169098660"
variation 3182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645804021"
variation 3183..3190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagaa"
/replace="aagaagaa"
/db_xref="dbSNP:1645804185"
variation 3183..3184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:763151419"
variation 3188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804239"
variation 3193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804313"
variation 3196..3198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:1645804382"
variation 3205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645804429"
variation 3208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005763656"
variation 3209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804548"
variation 3211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1335784510"
variation 3213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016780880"
variation 3214
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645804829"
variation 3216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010924348"
variation 3222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:116130930"
variation 3224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557625376"
variation 3226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294728825"
variation 3227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645805224"
variation 3229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:972530050"
variation 3230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977320190"
variation 3231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571381730"
variation 3232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023962631"
variation 3238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:16822444"
variation 3241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645805569"
variation 3260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1202542245"
variation 3265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645805687"
variation 3267..3272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1481124682"
variation 3273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1446614001"
variation 3275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645805834"
variation 3278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:979769602"
variation 3287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982470959"
variation 3289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:926829253"
variation 3290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645806069"
variation 3292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1406617402"
variation 3295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1450110270"
variation 3296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645806451"
variation 3298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645806516"
variation 3300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181016113"
variation 3302..3313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="ccaccccccacc"
/db_xref="dbSNP:1645806646"
variation 3305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:751161957"
variation 3307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157587098"
variation 3308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2057606"
variation 3309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402522809"
variation 3310
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766433433"
variation 3316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807023"
variation 3318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645807088"
variation 3320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148726602"
variation 3326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148726604"
variation 3328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:915647003"
variation 3330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774454425"
variation 3332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420740074"
variation 3335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303406314"
variation 3336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807432"
variation 3338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645807482"
variation 3341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645807546"
variation 3342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807607"
variation 3343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807682"
variation 3345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807739"
variation 3347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329847234"
variation 3349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807828"
variation 3355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:945440601"
variation 3359..3365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcc"
/replace="ctcctcc"
/db_xref="dbSNP:1235948754"
variation 3362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275775510"
variation 3363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1350357017"
variation 3364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645808081"
variation 3366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645808119"
variation 3369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645808158"
variation 3370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:949953054"
variation 3371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045968353"
variation 3376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759722423"
variation 3380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645808328"
variation 3383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:570108958"
variation 3384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1266648467"
variation 3388..3397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taa"
/replace="taatacttaa"
/db_xref="dbSNP:1645808475"
variation 3394..3396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tta"
/replace="ttatta"
/db_xref="dbSNP:1431340111"
variation 3394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1302778723"
variation 3399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042485212"
variation 3402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378011808"
variation 3404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645808743"
variation 3405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645808782"
variation 3407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1322040566"
variation 3428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363876827"
variation 3429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767682331"
variation 3431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148726670"
variation 3435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390382219"
variation 3437..3445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cttcc"
/replace="cttccttcc"
/db_xref="dbSNP:934536365"
variation 3439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645809082"
variation 3440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1324604644"
variation 3444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:369176195"
variation 3445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:933953211"
variation 3446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1275467706"
variation 3448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148726687"
variation 3449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:544835378"
variation 3450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226871979"
variation 3452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645809561"
variation 3458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645809599"
variation 3462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645809645"
variation 3463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1290514635"
variation 3464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756407221"
variation 3473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1309107602"
variation 3480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1018350753"
variation 3481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:777135778"
variation 3482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645810043"
variation 3483..3486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taat"
/replace="taataat"
/db_xref="dbSNP:767987739"
variation 3483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810115"
variation 3493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1005485340"
variation 3497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645810360"
variation 3502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1267896119"
variation 3503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810475"
variation 3504..3507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:899918123"
variation 3504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998372574"
variation 3505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810616"
variation 3507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413786257"
variation 3508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645810706"
variation 3509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1017159938"
variation 3512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:897013046"
variation 3517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810809"
variation 3518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:993907860"
variation 3522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645810891"
variation 3523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:372299339"
variation 3525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1030205426"
variation 3526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1490719297"
variation 3529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811096"
variation 3530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366224993"
variation 3531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:764601080"
variation 3532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:983409479"
variation 3534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811328"
variation 3535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811390"
variation 3536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645811438"
variation 3546..3551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="aggtag"
/db_xref="dbSNP:756900274"
variation 3548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564719281"
variation 3551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:11263836"
variation 3552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726754"
variation 3555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1310206743"
variation 3556..3568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ggaagaaataccc"
/db_xref="dbSNP:1645811737"
variation 3557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811799"
variation 3560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:868386416"
variation 3562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1351444886"
variation 3565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571382102"
variation 3566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414421664"
variation 3569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382775879"
variation 3571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645812125"
variation 3586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:537751988"
variation 3588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310777089"
variation 3589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812276"
variation 3591..3596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agaaag"
/db_xref="dbSNP:1323589881"
variation 3595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645812383"
variation 3596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440689421"
variation 3598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812500"
variation 3601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:559288688"
variation 3609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812623"
variation 3610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1163258781"
variation 3617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645812827"
variation 3620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991151309"
variation 3621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812964"
variation 3628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813038"
variation 3637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:979737204"
variation 3638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813196"
variation 3648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813267"
variation 3649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813358"
variation 3651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813438"
variation 3654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813486"
variation 3657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813558"
variation 3659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1253742631"
variation 3663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1426728596"
variation 3667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:570501842"
variation 3681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645813750"
variation 3685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180935385"
variation 3686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1253558654"
variation 3688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148726822"
variation 3691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425105622"
variation 3699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645814149"
variation 3702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1324508934"
variation 3704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:2148726831"
variation 3706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645814267"
variation 3710..3713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctc"
/replace="tctctc"
/db_xref="dbSNP:1645814366"
variation 3710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1034039916"
variation 3711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:959872642"
variation 3713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1353978258"
variation 3714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:915698048"
variation 3715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:989776856"
variation 3718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645814620"
variation 3725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:757779782"
variation 3730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645814719"
variation 3731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148726853"
variation 3734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440196918"
variation 3736..3743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cctggcct"
/replace="cctggcctggcct"
/db_xref="dbSNP:1645814975"
variation 3736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1299799751"
variation 3738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645815037"
variation 3739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571382230"
variation 3745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815140"
variation 3748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726863"
variation 3752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645815205"
variation 3753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:534583086"
variation 3754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381602990"
variation 3755..3778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cctccttttctccttattcctcct"
/replace="cctccttttctccttattcctccttttctccttattcctcct"
/db_xref="dbSNP:1553157181"
variation 3758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396729640"
variation 3766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294910497"
variation 3767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815599"
variation 3770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726875"
variation 3771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363066192"
variation 3774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815689"
variation 3777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1226112037"
variation 3779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:981302878"
variation 3781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815832"
variation 3783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1342612616"
variation 3785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778328049"
variation 3786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:745361943"
variation 3788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645816080"
variation 3790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1312596434"
variation 3791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645816207"
variation 3794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645816260"
variation 3801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726894"
variation 3802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645816341"
variation 3803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148726901"
variation 3809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:934611109"
variation 3810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645816494"
variation 3813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1361359690"
variation 3814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645816630"
variation 3817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1182044331"
variation 3818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645816747"
variation 3820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1246905719"
variation 3826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:922654018"
variation 3827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1228516462"
variation 3829..3830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:377610395"
variation 3835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:780857425"
variation 3840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414319373"
variation 3843..3845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:546902781"
variation 3843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206085009"
variation 3845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466769406"
variation 3851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645817287"
variation 3852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1320079218"
variation 3855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645817432"
variation 3856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726946"
variation 3857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645817503"
variation 3858..3862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tct"
/replace="tctct"
/db_xref="dbSNP:1645817555"
variation 3859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645817611"
variation 3860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:914485906"
variation 3861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11544095"
variation 3863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1645817850"
variation 3864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645817948"
variation 3864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1039642957"
variation 3865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:911246481"
variation 3870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645818052"
variation 3871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645818125"
variation 3872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218478003"
variation 3874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1383747021"
variation 3877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645818278"
variation 3884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1474000510"
variation 3887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:544171570"
variation 3888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645818496"
variation 3889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645818573"
variation 3892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210403066"
variation 3894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1267025830"
variation 3896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645818774"
variation 3897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941259690"
variation 3898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210045144"
variation 3906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557625954"
variation 3907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998653464"
variation 3912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726995"
variation 3916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419147558"
variation 3917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051283965"
variation 3921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645819124"
variation 3926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:574493933"
variation 3927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645819228"
variation 3929
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645819305"
variation 3930..3936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aga"
/replace="agaga"
/replace="agagaga"
/db_xref="dbSNP:1408443115"
variation 3930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541523978"
variation 3931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645819519"
variation 3936..3944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaacaaaa"
/db_xref="dbSNP:1645819640"
variation 3936..3939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148727018"
variation 3936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1158708063"
variation 3941..3944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaaa"
/db_xref="dbSNP:1410026095"
variation 3942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645819731"
variation 3945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645819774"
variation 3946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:896976019"
variation 3949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1172827157"
variation 3955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1401165263"
variation 3956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645819984"
variation 3960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1451767701"
variation 3961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645820089"
variation 3964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645820124"
variation 3965..3966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:1345756099"
variation 3970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1334655869"
variation 3971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004367048"
variation 3973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1219582033"
variation 3978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1287397808"
variation 3983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645820515"
variation 3987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:372998612"
variation 3990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1017237893"
variation 3993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645820656"
variation 3997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:373319406"
variation 3999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645820760"
variation 4000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229745842"
variation 4001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1268251248"
variation 4007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645820953"
variation 4008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645821031"
variation 4010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645821074"
variation 4011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727056"
variation 4019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:993969649"
variation 4025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012596617"
variation 4027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645821231"
variation 4028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448552286"
variation 4031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045604964"
variation 4032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:906930863"
variation 4034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821420"
variation 4037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821491"
variation 4045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489048022"
variation 4060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727077"
variation 4061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645821607"
variation 4062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1181892531"
variation 4068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:557125243"
variation 4071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821728"
variation 4073..4074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1645821768"
variation 4074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001311726"
variation 4075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1473677704"
variation 4086..4090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1645822036"
variation 4087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1034417264"
variation 4089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822170"
variation 4090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413184561"
variation 4091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382638"
variation 4094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382641"
variation 4098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:957094857"
variation 4099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011572868"
variation 4103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645822564"
variation 4104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822629"
variation 4105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:971191188"
variation 4107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022507355"
variation 4109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727119"
variation 4111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756144267"
variation 4112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645822899"
variation 4118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822953"
variation 4122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:575345163"
variation 4125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978201284"
variation 4127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626132"
variation 4129..4130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645823176"
variation 4130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411307035"
variation 4135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322270306"
variation 4136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727135"
variation 4142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:924373359"
variation 4143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203565985"
variation 4147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:922791500"
variation 4153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645823580"
variation 4156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645823649"
variation 4157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727146"
variation 4158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546120621"
variation 4159
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645823762"
variation 4162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645823818"
variation 4164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1444486087"
variation 4166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1204943412"
variation 4168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:564025142"
variation 4170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727163"
variation 4171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376079873"
variation 4173..4189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcact"
/replace="ctgcactgtcctgcact"
/db_xref="dbSNP:1645824056"
variation 4174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645824109"
variation 4175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1250105760"
variation 4178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:989931107"
variation 4183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645824277"
variation 4185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1183169742"
variation 4186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645824454"
variation 4188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645824508"
variation 4200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645824577"
variation 4203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237116217"
variation 4208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1471885737"
variation 4217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:780741067"
variation 4218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727183"
variation 4221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:576855548"
variation 4224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645824874"
variation 4227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541050685"
variation 4229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727191"
variation 4238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1425259445"
variation 4239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1196156313"
variation 4241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424382195"
variation 4243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431327702"
variation 4244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329204468"
variation 4258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148727201"
variation 4260..4265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtgt"
/replace="gtgtgt"
/db_xref="dbSNP:1645825345"
variation 4260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:943249793"
variation 4269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:749624548"
variation 4271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645825509"
variation 4273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:921234759"
variation 4281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645825620"
variation 4284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571382858"
variation 4291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645825732"
variation 4294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382833814"
variation 4302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:933993252"
variation 4303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645825989"
variation 4307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645826036"
variation 4309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645826076"
variation 4312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1344840620"
variation 4314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1291821976"
variation 4314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148727232"
variation 4319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727237"
variation 4322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645826237"
variation 4323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1206299477"
variation 4324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051641159"
variation 4334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645826361"
variation 4347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440880750"
variation 4348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:559288072"
variation 4355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1404346706"
variation 4356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645826631"
variation 4357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645826690"
variation 4359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238149641"
variation 4362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645826756"
variation 4363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571382930"
variation 4364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1414972830"
variation 4365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645826919"
variation 4367..4368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645827004"
variation 4367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382944"
variation 4368..4369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645827093"
variation 4368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199589770"
variation 4369..4388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttttt"
/replace="tttttttttt"
/replace="ttttttttttt"
/replace="ttttttttttttt"
/replace="tttttttttttttt"
/replace="tttttttttttttttttt"
/replace="ttttttttttttttttttt"
/replace="tttttttttttttttttttt"
/replace="ttttttttttttttttttttt"
/replace="tttttttttttttttttttttt"
/replace="ttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttttttt"
/db_xref="dbSNP:rs34158936"
variation 4369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1317317471"
variation 4379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645827510"
variation 4383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645827572"
variation 4386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645827616"
variation 4387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645827660"
variation 4388..4389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/replace="ttttttttttttttg"
/db_xref="dbSNP:1645827744"
variation 4388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1433708088"
variation 4389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1324502726"
variation 4389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645827857"
variation 4389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:78160010"
variation 4390..4392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148727293"
variation 4391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:80323450"
variation 4393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttttttat"
/db_xref="dbSNP:1344308844"
variation 4394..4404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gagacatgggg"
/db_xref="dbSNP:1571383009"
variation 4394..4399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gagaca"
/db_xref="dbSNP:1645828118"
variation 4394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1221227537"
variation 4395..4396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttt"
/db_xref="dbSNP:1571383021"
variation 4395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1264465139"
variation 4396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828282"
variation 4398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1347685404"
variation 4399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1246135635"
variation 4401..4404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gggg"
/db_xref="dbSNP:1201553074"
variation 4404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383053"
variation 4405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571383061"
variation 4408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1202415337"
variation 4410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1446323086"
variation 4412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828685"
variation 4414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828732"
variation 4415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828797"
variation 4416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828866"
variation 4418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645828904"
variation 4419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828946"
variation 4420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1038777167"
variation 4422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645829095"
variation 4423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206886008"
variation 4425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:887198165"
variation 4427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383099"
variation 4429..4430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1246165335"
variation 4432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1466173006"
variation 4433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148727341"
variation 4434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004418882"
variation 4435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645829765"
variation 4436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148727347"
variation 4437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283953973"
variation 4438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376878725"
variation 4440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:185636267"
variation 4445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645830052"
variation 4445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1038514020"
variation 4446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:548345110"
variation 4452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645830216"
variation 4455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1429539161"
variation 4460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:141020163"
variation 4462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1317924229"
variation 4471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045574832"
variation 4472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390154190"
variation 4475..4480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccccc"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:1264240367"
variation 4475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:907066780"
variation 4478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:531001823"
variation 4479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1235875938"
variation 4481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645830802"
variation 4481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1480146316"
variation 4483..4485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1571383214"
variation 4483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645830860"
variation 4487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001277575"
variation 4491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197277733"
variation 4492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379454699"
variation 4493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022652520"
variation 4495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157971224"
variation 4496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1382485104"
variation 4497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:971502052"
variation 4498..4500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1205659617"
variation 4499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1298430299"
variation 4500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:552938102"
variation 4501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645831457"
variation 4502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1266582286"
variation 4503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645831573"
variation 4504..4510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttttttt"
/db_xref="dbSNP:1364497161"
variation 4510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645831800"
variation 4515..4518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1645831867"
variation 4517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1002538732"
variation 4519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031870725"
variation 4520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472079739"
variation 4522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955779820"
variation 4527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302700761"
variation 4533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383330"
variation 4534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645832314"
variation 4538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645832379"
variation 4542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:3767701"
variation 4543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645832571"
variation 4544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727431"
variation 4548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645832655"
variation 4551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413552657"
variation 4553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1453774936"
variation 4556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163253086"
variation 4562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:535305390"
variation 4563..4565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="ttttt"
/db_xref="dbSNP:1645833042"
variation 4565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1388934119"
variation 4566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:546631807"
variation 4570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:989942450"
variation 4571..4581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gcctgggcttg"
/db_xref="dbSNP:1645833247"
variation 4574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:892881648"
variation 4575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571383382"
variation 4583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645833421"
variation 4584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011206378"
variation 4585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:567921238"
variation 4587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:966909637"
variation 4589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:914383203"
variation 4592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383404"
variation 4595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:999755697"
variation 4601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264842778"
variation 4607..4608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645833861"
variation 4609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1354127015"
variation 4611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645833991"
variation 4616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:529226907"
variation 4623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1224575972"
variation 4624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727485"
variation 4634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:11263837"
variation 4636..4652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tggagg"
/replace="tggaggccagctggagg"
/db_xref="dbSNP:1482570994"
variation 4637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955570714"
variation 4643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834334"
variation 4645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490230038"
variation 4646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1252219325"
variation 4658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571383462"
variation 4659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:985943795"
variation 4662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:147872657"
variation 4664..4666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1367279967"
variation 4672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645834800"
variation 4674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834859"
variation 4675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834930"
variation 4679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645835003"
variation 4683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:575432473"
variation 4688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727526"
variation 4689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164723063"
variation 4692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626633"
variation 4698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180986599"
variation 4701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:538396559"
variation 4702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1441473989"
variation 4703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835457"
variation 4707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645835540"
variation 4708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835612"
variation 4712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1158965724"
variation 4713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645835712"
variation 4716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645835761"
variation 4718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:768629161"
variation 4722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1422319454"
variation 4724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835966"
variation 4725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:539225992"
variation 4734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390797034"
variation 4735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645836125"
variation 4741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390373559"
variation 4743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1328762082"
variation 4744..4750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atc"
/replace="atctatc"
/db_xref="dbSNP:1248093606"
variation 4744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940048856"
variation 4745..4747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1341276282"
variation 4747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645836434"
variation 4748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549478819"
variation 4751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645836515"
variation 4754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:981391115"
variation 4758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645836622"
variation 4759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928450240"
variation 4763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571383569"
variation 4766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645836781"
variation 4775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645836821"
variation 4781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645836891"
variation 4781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:937119553"
variation 4784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:898638537"
variation 4786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:948854920"
variation 4789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1045068402"
variation 4791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1056043426"
variation 4793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383595"
variation 4796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002958675"
variation 4797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:374604719"
variation 4799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:891564764"
variation 4805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645837338"
variation 4807..4814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="catt"
/replace="cattcatt"
/db_xref="dbSNP:568286493"
variation 4817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:779127991"
variation 4821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645837495"
variation 4827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645837557"
variation 4837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645837592"
variation 4838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1172946442"
variation 4841..4845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taact"
/replace="taactaact"
/db_xref="dbSNP:763091191"
variation 4844..4851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcct"
/replace="ctcctcct"
/db_xref="dbSNP:1465749168"
variation 4844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301254589"
variation 4845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1404445156"
variation 4846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:566005717"
variation 4847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645837930"
variation 4865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:557502697"
variation 4869..4876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gc"
/replace="gctacagc"
/db_xref="dbSNP:1557626785"
variation 4871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:776479735"
variation 4873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1267521187"
variation 4877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838154"
variation 4878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838239"
variation 4887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748073066"
variation 4889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357140818"
variation 4891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:148920115"
variation 4894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838456"
variation 4896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1041364990"
variation 4897..4898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645838643"
variation 4897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838592"
variation 4898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838705"
variation 4905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:551183965"
variation 4906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1307814250"
variation 4915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232095258"
variation 4917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645838886"
variation 4919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838928"
variation 4925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838966"
variation 4926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253817472"
variation 4928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:559700666"
variation 4933..4934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1203738330"
variation 4938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645839164"
variation 4939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247992782"
variation 4940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383731"
variation 4943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179212155"
variation 4944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:974546690"
variation 4950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645839412"
variation 4951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645839464"
variation 4952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:999722784"
variation 4957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1029906678"
variation 4961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:574738407"
variation 4962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1432895085"
variation 4963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:891379793"
variation 4966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645839882"
variation 4967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174300866"
variation 4979..4984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1030698125"
variation 4983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:954617636"
variation 4990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645840096"
variation 4995..4997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="act"
/db_xref="dbSNP:1645840140"
variation 4996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645840201"
variation 4998..4999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1645840255"
variation 4999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645840310"
variation 5002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1319940523"
variation 5004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645840847"
variation 5005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:749135264"
variation 5006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987209249"
variation 5011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626922"
variation 5012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571383810"
variation 5013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:908518241"
variation 5016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1362408292"
variation 5025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1298812667"
variation 5027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841240"
variation 5030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:940101447"
variation 5033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645841340"
variation 5034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841375"
variation 5037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774314069"
variation 5038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645841478"
variation 5040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018878974"
variation 5043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1326383796"
variation 5047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841621"
variation 5048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:962811047"
variation 5049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:569028747"
variation 5050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218561159"
variation 5051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841805"
variation 5053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:974593532"
variation 5062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1243192888"
variation 5063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1488390585"
variation 5068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727754"
variation 5070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401866702"
variation 5074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727758"
variation 5081
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727763"
variation 5087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1271378698"
variation 5088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1025644941"
variation 5089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:528581690"
variation 5090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645842188"
variation 5092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759576331"
variation 5095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842281"
variation 5097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842329"
variation 5099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:919992705"
variation 5104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1409869642"
variation 5112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842477"
variation 5114..5117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:948897736"
variation 5114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645842520"
variation 5116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161287709"
variation 5117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1382484440"
variation 5118..5134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctaggatcagggcacta"
/replace="ctaggatcagggcactaggatcagggcacta"
/db_xref="dbSNP:1645842729"
variation 5118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842691"
variation 5120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1345701651"
variation 5122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142820733"
variation 5126..5127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1645842850"
variation 5132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1435560919"
variation 5134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645842923"
variation 5138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:11584551"
variation 5139
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301096853"
variation 5140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1347106387"
variation 5141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843246"
variation 5143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1405193284"
variation 5147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:951399769"
variation 5148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1315279151"
variation 5150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843426"
variation 5153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843474"
variation 5155..5156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tc"
/db_xref="dbSNP:1322495713"
variation 5164..5166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645843565"
variation 5166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148727824"
variation 5170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044534109"
variation 5171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1285628921"
variation 5177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226998190"
variation 5178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645843752"
variation 5179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384016"
variation 5185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1219960188"
variation 5188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294435310"
variation 5189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645843975"
variation 5190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645844021"
variation 5191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384041"
variation 5192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844138"
variation 5196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:907449262"
variation 5198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:536462158"
variation 5203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:563614918"
variation 5212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181737936"
variation 5218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1249885644"
variation 5220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:531160067"
variation 5221..5230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttctctcctt"
/replace="ttctctccttctctcctt"
/db_xref="dbSNP:1645844480"
variation 5223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844528"
variation 5228..5230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctt"
/db_xref="dbSNP:1645844611"
variation 5228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:552823877"
variation 5230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:879655926"
variation 5234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844688"
variation 5236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1404716895"
variation 5237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1161533657"
variation 5239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1367212903"
variation 5240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425058234"
variation 5242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844925"
variation 5243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571384105"
variation 5244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645845050"
variation 5244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1307085474"
variation 5246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845099"
variation 5249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727887"
variation 5254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767735487"
variation 5255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:552050201"
variation 5259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:528802065"
variation 5269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443788207"
variation 5270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845349"
variation 5272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:190099919"
variation 5273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845472"
variation 5276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256609372"
variation 5277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845584"
variation 5283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021369384"
variation 5286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:947143594"
variation 5292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645845708"
variation 5293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:182744550"
variation 5294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571384166"
variation 5300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204874862"
variation 5301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845899"
variation 5306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148727918"
variation 5308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645845949"
variation 5313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1272814860"
variation 5316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1190613951"
variation 5321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846085"
variation 5327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846135"
variation 5331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846189"
variation 5332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:151051297"
variation 5337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1205425860"
variation 5340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465746348"
variation 5341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1172008691"
variation 5343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384210"
variation 5344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1471812605"
variation 5348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727946"
variation 5351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405911669"
variation 5355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645846538"
variation 5356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902852262"
variation 5357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645846623"
variation 5358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645846660"
variation 5360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:954806567"
variation 5361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846742"
variation 5363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:983361467"
variation 5369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645846852"
variation 5375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645846900"
variation 5376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645846957"
variation 5378..5384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/db_xref="dbSNP:1645847010"
variation 5390..5393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaga"
/db_xref="dbSNP:1645847063"
variation 5395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148727972"
variation 5401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1167691315"
variation 5403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847159"
variation 5406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1394022800"
variation 5408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:932947717"
variation 5411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645847305"
variation 5414..5416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ata"
/replace="atata"
/db_xref="dbSNP:1329050564"
variation 5416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847415"
variation 5417..5420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1358079609"
variation 5420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772382251"
variation 5421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550680342"
variation 5424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1384154969"
variation 5426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645847733"
variation 5427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:961395198"
variation 5429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847828"
variation 5429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645847862"
variation 5431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645847914"
variation 5433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728004"
variation 5448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847954"
variation 5450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764511304"
variation 5451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1341839128"
variation 5452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:187348990"
variation 5455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278180244"
variation 5457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440823891"
variation 5459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645848224"
variation 5460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848273"
variation 5466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:970088425"
variation 5468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848359"
variation 5469..5474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtg"
/replace="gtggtg"
/db_xref="dbSNP:1645848479"
variation 5469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1276597545"
variation 5471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461734061"
variation 5473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571384324"
variation 5474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1342434963"
variation 5480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848655"
variation 5484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219399290"
variation 5492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:539113284"
variation 5493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980694120"
variation 5494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1371146862"
variation 5495..5496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1645848996"
variation 5495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:891356896"
variation 5496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645849048"
variation 5497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401665842"
variation 5501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1310304736"
variation 5505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849252"
variation 5519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928789700"
variation 5522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256324753"
variation 5524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1467820619"
variation 5525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:557539448"
variation 5526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849521"
variation 5528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148728056"
variation 5530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754200663"
variation 5531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645849600"
variation 5532..5533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:749776818"
variation 5541..5543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gtg"
/db_xref="dbSNP:1645849756"
variation 5541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757754773"
variation 5543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435029828"
variation 5545..5546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1316774797"
variation 5545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1320249981"
variation 5547..5551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1328627531"
variation 5547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849999"
variation 5548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850105"
variation 5549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850140"
variation 5551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557627407"
variation 5553..5557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ccccc"
/db_xref="dbSNP:1645850330"
variation 5553..5557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:770805142"
variation 5553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018434015"
variation 5555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645850511"
variation 5557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:898696084"
variation 5560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645850599"
variation 5561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274532947"
variation 5564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:41308339"
variation 5569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645850811"
variation 5576..5578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1645850893"
variation 5576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850851"
variation 5578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225535156"
variation 5580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1477947563"
variation 5581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1025695548"
variation 5583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197997922"
variation 5585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1263862850"
variation 5588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:951451722"
variation 5590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851215"
variation 5593
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328507462"
variation 5594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645851305"
variation 5598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002846536"
variation 5610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204485880"
variation 5611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1035711401"
variation 5612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426622329"
variation 5613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645851511"
variation 5618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448579369"
variation 5619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851605"
variation 5622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851648"
variation 5627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728166"
variation 5629..5631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1193605967"
variation 5629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:958630214"
variation 5633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851808"
variation 5637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1479270221"
variation 5644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728182"
variation 5645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1178071830"
variation 5646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645851930"
variation 5652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851973"
variation 5656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042669059"
variation 5658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1456242492"
variation 5661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852094"
variation 5663..5666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:759259838"
variation 5663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852142"
variation 5666..5677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgcttgcttgct"
/replace="tgcttgcttgcttgct"
/db_xref="dbSNP:900265053"
variation 5666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645852241"
variation 5667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645852361"
variation 5671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401689084"
variation 5674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852451"
variation 5675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:191912446"
variation 5677..5678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tgctggcc"
/db_xref="dbSNP:1553157487"
variation 5678..5685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggcc"
/replace="ggccggcc"
/replace="ggccggccggcc"
/db_xref="dbSNP:1296575768"
variation 5679..5693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gccggcctgcctgcc"
/replace="gccggcctgcctgccggcctgcctgcc"
/db_xref="dbSNP:1362617855"
variation 5679..5689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gccggcctgcc"
/replace="gccggcctgccggcctgcc"
/db_xref="dbSNP:1645852668"
variation 5680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852759"
variation 5681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:914403513"
variation 5682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:968992815"
variation 5683..5715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcctgcctgcctg"
/replace="gcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
g"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
gcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
gcctgcctg"
/db_xref="dbSNP:rs372821782"
variation 5683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282666371"
variation 5685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645853224"
variation 5686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1365616037"
variation 5686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:977225175"
variation 5687..5693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcctgcc"
/replace="gcctgccggcctgcc"
/db_xref="dbSNP:747270933"
variation 5687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426944064"
variation 5689..5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1571384632"
variation 5689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301971013"
variation 5690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370162251"
variation 5691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1389789240"
variation 5693..5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcctgcctgcctgcctgcctgtctgcct"
/replace="ctgcctgcctgcctgcctgcctgtctgcctgcctgcctgcctgcctgt
ctgcct"
/db_xref="dbSNP:1645853684"
variation 5694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645853731"
variation 5697..5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgcctgtctgcct"
/replace="ctgcctgcctgcctgcctgtctgcctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1645853771"
variation 5698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1316118886"
variation 5699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1309282984"
variation 5700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645854320"
variation 5701..5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1336375849"
variation 5703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384653"
variation 5704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:963254787"
variation 5705..5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgtctgcct"
/replace="ctgcctgcctgtctgcctgcctgtctgcct"
/db_xref="dbSNP:1237611797"
variation 5707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645854627"
variation 5708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:555364099"
variation 5709..5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgtctgcct"
/replace="ctgcctgtctgcctgtctgcct"
/db_xref="dbSNP:1287917302"
variation 5709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1292098066"
variation 5710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645854848"
variation 5711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645854897"
variation 5712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557627632"
variation 5713..5724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctgtctgcctat"
/db_xref="dbSNP:1252062550"
variation 5713..5719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgtctg"
/replace="ctgtctgtctg"
/db_xref="dbSNP:200133723"
variation 5713..5715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgactg"
/db_xref="dbSNP:1553157504"
variation 5715..5716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="cc"
/db_xref="dbSNP:770398111"
variation 5716..5717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gc"
/db_xref="dbSNP:1645855334"
variation 5716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:112770520"
variation 5717..5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcct"
/db_xref="dbSNP:1183589156"
variation 5718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645855424"
variation 5719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:571445890"
variation 5721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645855513"
variation 5738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645855558"
variation 5740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645855603"
variation 5745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1383916478"
variation 5749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051361821"
variation 5753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1164574343"
variation 5754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645855799"
variation 5760
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1389894962"
variation 5762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1221324706"
variation 5767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1026961947"
variation 5769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:910240712"
variation 5772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1395510442"
variation 5773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:942960160"
variation 5775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757921944"
variation 5776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1489203442"
variation 5780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1380448830"
variation 5781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1193414679"
variation 5782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384799"
variation 5784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775414815"
variation 5786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645856560"
variation 5788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315494134"
variation 5789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:898752248"
variation 5790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1224797571"
variation 5795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:928691509"
variation 5796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202463972"
variation 5797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:996046803"
variation 5800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645856886"
variation 5801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148728410"
variation 5803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419008182"
variation 5806..5807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1241877536"
variation 5806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1463077268"
variation 5807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1047275375"
variation 5808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857163"
variation 5810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1184703413"
variation 5813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:887166316"
variation 5814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1427104575"
variation 5816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002980449"
variation 5821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420492800"
variation 5829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857445"
variation 5838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645857490"
variation 5840..5841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645857539"
variation 5841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645857582"
variation 5844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857646"
variation 5848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1302816968"
variation 5851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035677605"
variation 5856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:913494355"
variation 5857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728446"
variation 5858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645857860"
variation 5860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857900"
variation 5867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557627845"
variation 5876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645857980"
variation 5883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571384916"
variation 5884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174403877"
variation 5892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762492099"
variation 5897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:958990209"
variation 5898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:779696256"
variation 5900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1337231783"
variation 5906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1380300635"
variation 5910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645858678"
variation 5913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1297341203"
variation 5914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1307689490"
variation 5919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:947601773"
variation 5923
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260732717"
variation 5929
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645859042"
variation 5932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645859089"
variation 5937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324999845"
variation 5939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204871772"
variation 5944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1438787912"
variation 5947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645859379"
variation 5949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1021921367"
variation 5950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:968671573"
variation 5958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763849097"
variation 5960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645859555"
variation 5963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042724086"
variation 5964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645859650"
variation 5965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645859708"
variation 5966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:567274274"
variation 5981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661619"
variation 5982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:150347120"
variation 5986..5990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1431544208"
variation 5989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987216748"
variation 5990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546276346"
variation 5991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470343952"
variation 5993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:910216586"
variation 5998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344515647"
variation 6013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860254"
variation 6019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:192229737"
variation 6022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1290445387"
variation 6023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362339452"
variation 6029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1403969851"
variation 6033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860504"
variation 6034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1244761611"
variation 6034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1287368967"
variation 6036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1037381878"
variation 6041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645860681"
variation 6045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148728519"
variation 6047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1280900615"
variation 6051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860783"
variation 6058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1346907933"
variation 6059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:920145968"
variation 6060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645860929"
variation 6068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528689854"
variation 6070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645861030"
variation 6071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1284226539"
variation 6073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:931573500"
variation 6075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315693552"
variation 6076
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:540957769"
variation 6087..6090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1221573684"
variation 6088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645861365"
variation 6093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368046981"
variation 6095..6104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gagaa"
/replace="gagaagagaa"
/db_xref="dbSNP:1645861470"
variation 6099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1490268876"
variation 6105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231826043"
variation 6107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457670138"
variation 6109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220619177"
variation 6111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1271306211"
variation 6118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1047241439"
variation 6122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1004756207"
variation 6125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645861848"
variation 6132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405839722"
variation 6140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:769653660"
variation 6147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645861970"
variation 6160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417265705"
variation 6162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148728576"
variation 6169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161126832"
variation 6171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360937850"
variation 6173..6177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gatcc"
/replace="gatccgatcc"
/db_xref="dbSNP:1645862149"
variation 6182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:562224713"
variation 6184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:899097755"
variation 6187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1002947890"
variation 6189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057471908"
variation 6193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645862459"
variation 6197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645862508"
variation 6199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:138074007"
variation 6200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645862610"
variation 6208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645862666"
variation 6210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440747757"
variation 6213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645862778"
variation 6214
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1162890296"
variation 6218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645862869"
variation 6224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:894562681"
variation 6226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754406043"
variation 6228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728607"
variation 6233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:772201195"
variation 6237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148728609"
variation 6250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645863100"
variation 6251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645863154"
variation 6252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1021640249"
variation 6258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:141089342"
variation 6259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998758461"
variation 6260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1244212532"
variation 6260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294278586"
variation 6262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490584781"
variation 6263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:960365327"
variation 6264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775545090"
variation 6265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1481620700"
variation 6267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:568795494"
variation 6269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380815145"
variation 6270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645863841"
variation 6274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:987268068"
variation 6282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1443819358"
variation 6285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:144915813"
variation 6287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571385299"
variation 6288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864076"
variation 6290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864138"
variation 6291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1377348939"
variation 6292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645864227"
variation 6298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:374706238"
variation 6299
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:113615155"
variation 6301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864372"
variation 6306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645864425"
variation 6307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1282216452"
variation 6313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645864544"
variation 6314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645864590"
variation 6317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405605719"
variation 6319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645864668"
variation 6321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380813945"
variation 6323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:973456920"
variation 6324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728666"
variation 6325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864840"
variation 6326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645864882"
variation 6328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:760929529"
variation 6331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551057779"
variation 6334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645865280"
variation 6335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1332689680"
variation 6337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:114256824"
variation 6338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197273641"
variation 6340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645865489"
variation 6342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:184309288"
variation 6354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:983063796"
variation 6358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260624813"
variation 6359..6363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttt"
/replace="tttttt"
/db_xref="dbSNP:1645865803"
variation 6361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458613385"
variation 6363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645865916"
variation 6364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:922161015"
variation 6370..6378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttt"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/db_xref="dbSNP:370557448"
variation 6370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1309399501"
variation 6376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866192"
variation 6377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866233"
variation 6378..6379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aaa"
/db_xref="dbSNP:1645866326"
variation 6378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:987536748"
variation 6379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1187213249"
variation 6380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385436"
variation 6381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1236111557"
variation 6382..6384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:911645288"
variation 6385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1473876167"
variation 6389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181616122"
variation 6394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940409522"
variation 6401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472999025"
variation 6404..6405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:1167019359"
variation 6404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866716"
variation 6405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1182705289"
variation 6409..6414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gggcag"
/db_xref="dbSNP:1645866894"
variation 6411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1036208175"
variation 6416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571385482"
variation 6421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645867033"
variation 6422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728745"
variation 6423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:555660904"
variation 6425..6431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="act"
/replace="actgact"
/db_xref="dbSNP:1422983575"
variation 6425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404662978"
variation 6427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867197"
variation 6431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1451113438"
variation 6432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1339192698"
variation 6434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1341515389"
variation 6437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430446901"
variation 6440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464188223"
variation 6442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645867423"
variation 6445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867458"
variation 6448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645867490"
variation 6449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1364387032"
variation 6456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867572"
variation 6460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:572628298"
variation 6463..6464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1201765786"
variation 6467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645867751"
variation 6471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:930444612"
variation 6473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645867836"
variation 6480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045041411"
variation 6481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:530603610"
variation 6488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:78530614"
variation 6489..6490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1476204564"
variation 6489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645868037"
variation 6490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:894522255"
variation 6492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:776882598"
variation 6497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868215"
variation 6499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645868270"
variation 6501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1448255656"
variation 6504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269278192"
variation 6505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948849183"
variation 6508..6509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645868454"
variation 6511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868500"
variation 6512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762170192"
variation 6514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043438858"
variation 6517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868671"
variation 6518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385608"
variation 6522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1403509038"
variation 6523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645868786"
variation 6525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868819"
variation 6529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:904567735"
variation 6537..6538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1400592274"
variation 6538..6545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tca"
/replace="tcatctca"
/db_xref="dbSNP:1219867000"
variation 6538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645868959"
variation 6540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645869071"
variation 6541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645869125"
variation 6543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645869167"
variation 6544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765675340"
variation 6545..6547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1328506458"
variation 6548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571385649"
variation 6552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1319157924"
variation 6556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1343778835"
variation 6559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557084074"
variation 6567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1036062361"
variation 6569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276584304"
variation 6574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:895920140"
variation 6576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276910052"
variation 6577..6578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645869877"
variation 6577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:575661209"
variation 6578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645869937"
variation 6579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645869988"
variation 6582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1010249007"
variation 6584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:2148728856"
variation 6584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645870081"
variation 6585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1020314191"
variation 6586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:546362220"
variation 6595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1479199859"
variation 6597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645870356"
variation 6599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890382760"
variation 6600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1008657978"
variation 6603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763548820"
variation 6607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157272761"
variation 6609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645870598"
variation 6610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953725615"
variation 6614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645870679"
variation 6615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:964799598"
variation 6618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302826706"
variation 6625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645870815"
variation 6628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:973205940"
variation 6635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:911516959"
variation 6636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645870970"
variation 6639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195863102"
variation 6641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424452573"
variation 6645..6650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1477632037"
variation 6645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:940323449"
variation 6648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:920339228"
variation 6651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1355662531"
variation 6654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170784368"
variation 6655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:930497110"
variation 6662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571385821"
variation 6665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645871464"
variation 6666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645871530"
variation 6671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1290634553"
variation 6673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645871697"
variation 6673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:558270328"
variation 6674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1211203653"
variation 6677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044886782"
variation 6680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:138767681"
variation 6683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:939242447"
variation 6689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:950401389"
variation 6692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1185440121"
variation 6694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1057145760"
variation 6696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872395"
variation 6697
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:895835109"
variation 6699..6703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:1440738836"
variation 6702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571385873"
variation 6711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:879157668"
variation 6713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872617"
variation 6721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872675"
variation 6729
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645872766"
variation 6731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872813"
variation 6734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645872840"
variation 6737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163376199"
variation 6738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645872979"
variation 6739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:983116176"
variation 6742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1383722185"
variation 6743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:908759750"
variation 6745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728950"
variation 6746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728953"
variation 6747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:540494493"
variation 6748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1395952822"
variation 6750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645873310"
variation 6754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:904610426"
variation 6755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385919"
variation 6758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148728967"
variation 6761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1326832455"
variation 6764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:371613930"
variation 6768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645873813"
variation 6769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447359167"
variation 6770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:10159166"
variation 6772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953666043"
variation 6773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385961"
variation 6775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344366892"
variation 6776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874205"
variation 6780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:916104249"
variation 6782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874331"
variation 6784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874374"
variation 6793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874429"
variation 6794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:373746606"
variation 6796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1265650361"
variation 6798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1009590328"
variation 6800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645874686"
variation 6801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:544844168"
variation 6807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386002"
variation 6810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:375483845"
variation 6811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645874945"
variation 6812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1458625794"
variation 6813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019173380"
variation 6814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875109"
variation 6815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875195"
variation 6817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273645163"
variation 6818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875305"
variation 6821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1165828405"
variation 6823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875441"
variation 6825
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:746073637"
variation 6826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645875572"
variation 6829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645875655"
variation 6830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875707"
variation 6832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1460567228"
variation 6841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875815"
variation 6842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645875867"
variation 6844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875920"
variation 6847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645875969"
variation 6849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876036"
variation 6855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1169758238"
variation 6856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:961745768"
variation 6861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:562192835"
variation 6862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1043187507"
variation 6866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:904619927"
variation 6872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380376895"
variation 6881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729053"
variation 6891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645876532"
variation 6896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397538632"
variation 6900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876620"
variation 6903..6905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1313037150"
variation 6909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876714"
variation 6910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487402670"
variation 6911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876817"
variation 6913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645876859"
variation 6915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:920349220"
variation 6919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148729069"
variation 6922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645876981"
variation 6925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779121299"
variation 6926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645877127"
variation 6930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729074"
variation 6932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:532756658"
variation 6936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645877237"
variation 6938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:551094472"
variation 6944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645877341"
variation 6945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645877397"
variation 6947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645877438"
variation 6948..6949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1645877485"
variation 6949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877531"
variation 6951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1053063998"
variation 6954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645877620"
variation 6965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371449404"
variation 6969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980648055"
variation 6974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1317917409"
variation 6979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645877810"
variation 6984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203660652"
variation 6987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877886"
variation 6989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1263954548"
variation 6989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877939"
variation 6996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1484473665"
variation 6997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1182776319"
variation 6999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878184"
variation 7002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890351554"
variation 7003
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748582631"
variation 7004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451154583"
variation 7018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878407"
variation 7020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426972330"
variation 7025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645878525"
variation 7028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386195"
variation 7029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196028282"
variation 7030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645878800"
variation 7032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1008842113"
variation 7034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878921"
variation 7037..7042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="caca"
/replace="cacaca"
/db_xref="dbSNP:926420699"
variation 7037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645878969"
variation 7052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1379364534"
variation 7054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:186734072"
variation 7060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:755885015"
variation 7062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1467484723"
variation 7068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645879289"
variation 7070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:913819772"
variation 7075..7080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agc"
/replace="agcagc"
/db_xref="dbSNP:2148729156"
variation 7077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:527357395"
variation 7078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:900365728"
variation 7084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157779349"
variation 7086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:946087269"
variation 7087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645879642"
variation 7089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378292176"
variation 7091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1222356299"
variation 7094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645879833"
variation 7095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645879888"
variation 7099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729179"
variation 7100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:777420444"
variation 7101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314501170"
variation 7102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880056"
variation 7104..7106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctc"
/db_xref="dbSNP:1645880102"
variation 7106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041669384"
variation 7119
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386294"
variation 7120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645880326"
variation 7121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880377"
variation 7125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645880421"
variation 7130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645880469"
variation 7134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880596"
variation 7142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645880650"
variation 7153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639867973"
variation 7154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:558373845"
variation 7155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:904621610"
variation 7160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1485093351"
variation 7163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219140446"
variation 7174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000206497"
variation 7178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729205"
variation 7179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772267788"
variation 7181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027366153"
variation 7184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197401612"
variation 7190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729212"
variation 7192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:889305740"
variation 7193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:749293608"
variation 7194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645881473"
variation 7196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645881534"
variation 7212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1176622861"
variation 7215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363083094"
variation 7217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:548918631"
variation 7221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019646938"
variation 7222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004521790"
variation 7228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324961860"
variation 7231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360735202"
variation 7232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1333275975"
variation 7233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:567411609"
variation 7244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369010287"
variation 7245..7248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgta"
/replace="tgtatgta"
/db_xref="dbSNP:1442309469"
variation 7246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220376437"
variation 7249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882353"
variation 7250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770825835"
variation 7251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882492"
variation 7252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027300752"
variation 7253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1287140063"
variation 7258..7259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gt"
/db_xref="dbSNP:1490253808"
variation 7259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645882705"
variation 7262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951788921"
variation 7267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980959266"
variation 7272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488846783"
variation 7275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1352008025"
variation 7276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882980"
variation 7277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645883030"
variation 7279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1249705353"
variation 7280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645883150"
variation 7285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:544330785"
variation 7288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645883275"
variation 7290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645883329"
variation 7292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413972925"
variation 7298..7299
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645883489"
variation 7298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:960864590"
variation 7303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:537750959"
variation 7305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:993129847"
variation 7307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:916062408"
variation 7308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1351170931"
variation 7311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645883831"
variation 7313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149237486"
variation 7315..7319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ca"
/replace="catca"
/db_xref="dbSNP:913831161"
variation 7315..7316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ca"
/replace="cagca"
/db_xref="dbSNP:539061324"
variation 7317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:144443110"
variation 7318..7340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cagcagcagca"
/replace="cagcagcagcagca"
/replace="cagcagcagcagcagca"
/replace="cagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagcagcagca"
/db_xref="dbSNP:rs889197162"
variation 7318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1355722293"
variation 7319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203872063"
variation 7320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:575056563"
variation 7324..7325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttgttgt"
/db_xref="dbSNP:1269588845"
variation 7327..7328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctatggct"
/db_xref="dbSNP:1452072720"
variation 7329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1177987270"
variation 7333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1456405949"
variation 7336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cttc"
/db_xref="dbSNP:1645885688"
variation 7336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645885640"
variation 7338..7339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gc"
/replace="gcggc"
/db_xref="dbSNP:1645885789"
variation 7338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180372984"
variation 7341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645885837"
variation 7342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645885889"
variation 7346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645885938"
variation 7347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148729327"
variation 7348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:934766659"
regulatory 7354..7359
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: TATAAA"
variation 7355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645886069"
variation 7357..7359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1645886176"
variation 7357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645886118"
variation 7358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645886223"
variation 7360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:539822482"
variation 7361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645886321"
variation 7363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645886384"
variation 7365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729344"
variation 7366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:191490961"
variation 7367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645886496"
variation 7368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645886526"
variation 7369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:147996549"
variation 7374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:534259020"
variation 7375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:944611441"
variation 7376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571386624"
variation 7377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645886834"
variation 7380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386633"
variation 7381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1367463573"
variation 7382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645887018"
variation 7383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:184023415"
polyA_site 7384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="major polyA site"
variation 7388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:574175798"
variation 7389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:544618983"
variation 7391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571386676"
variation 7395..7399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tctct"
/db_xref="dbSNP:1645887327"
variation 7399..7407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/replace="ttttttttttt"
/db_xref="dbSNP:rs796351016"
variation 7405..7406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148729387"
variation 7406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645887490"
variation 7407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:867387436"
variation 7408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390866641"
variation 7415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571386715"
variation 7416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286216662"
variation 7417..7420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148729393"
variation 7417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:188911199"
variation 7422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645887831"
variation 7425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1214158289"
variation 7428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256255072"
variation 7429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645887970"
variation 7433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645888019"
variation 7434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:960456203"
variation 7438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645888120"
variation 7440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1048938605"
variation 7442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:182195447"
variation 7446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:577246142"
variation 7447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645888320"
variation 7448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645888365"
variation 7454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004657513"
variation 7457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207790449"
variation 7472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238937216"
variation 7480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472929518"
variation 7484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645888623"
variation 7485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645888676"
variation 7486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:770258663"
variation 7490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645889020"
variation 7491..7492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1420923125"
variation 7491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1034669992"
variation 7494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1172080513"
variation 7500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:960444785"
variation 7508..7511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tcat"
/db_xref="dbSNP:1413226399"
variation 7511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1336586532"
variation 7514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:979339120"
variation 7518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430287896"
variation 7520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276524536"
variation 7521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340047651"
variation 7522..7523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:746001460"
variation 7523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:925197893"
variation 7527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571386829"
variation 7532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267273030"
variation 7534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219290317"
variation 7537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645889940"
variation 7539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1282674801"
variation 7544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890236"
variation 7548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645890277"
variation 7551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645890320"
variation 7555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344247107"
variation 7557..7560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1645890475"
variation 7557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:773678037"
variation 7559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645890524"
variation 7560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1280477276"
variation 7563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645890662"
variation 7564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1442783041"
variation 7570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197921213"
variation 7571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:986114472"
variation 7573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890878"
variation 7575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890925"
variation 7576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260563689"
variation 7582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891060"
variation 7591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891097"
variation 7597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645891142"
variation 7599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489008222"
variation 7600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763601554"
variation 7601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766939124"
variation 7603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1477336117"
variation 7607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645891407"
variation 7609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1178959666"
variation 7610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255242825"
variation 7613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891545"
variation 7614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023183515"
variation 7616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1189238389"
variation 7627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645891676"
variation 7632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891738"
variation 7635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296624955"
variation 7636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891932"
variation 7637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:970729207"
variation 7639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:978931276"
variation 7643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:185476341"
variation 7645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645892133"
variation 7647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645892172"
variation 7650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645892214"
variation 7651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:956112691"
variation 7652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477240493"
variation 7653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:759023126"
variation 7659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645892407"
variation 7660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302643848"
variation 7670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645892494"
variation 7672..7676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatga"
/db_xref="dbSNP:2148729521"
variation 7673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645892547"
variation 7674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:911887757"
variation 7675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:898025322"
variation 7678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661620"
variation 7679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049380833"
variation 7683..7685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gga"
/replace="ggagga"
/db_xref="dbSNP:1645892854"
variation 7683..7684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:764616411"
variation 7684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239124372"
variation 7688..7689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645892937"
variation 7692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1283570239"
variation 7694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039451250"
variation 7698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:921842803"
variation 7699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893134"
variation 7701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1355436608"
variation 7702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:527401943"
variation 7705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1467667265"
variation 7706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893334"
variation 7709..7711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:71573710"
variation 7717..7719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1201704138"
variation 7719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893459"
variation 7726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1048906465"
variation 7731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1299064106"
variation 7734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247766098"
variation 7735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549014350"
variation 7737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1157249630"
variation 7739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:752455063"
variation 7744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645893821"
variation 7748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1394491176"
variation 7755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:888029350"
variation 7756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:141708021"
variation 7767..7773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggag"
/replace="ggaggag"
/db_xref="dbSNP:1330261261"
variation 7770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:896232710"
variation 7772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387090"
variation 7780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645894291"
variation 7784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387095"
variation 7784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645894397"
variation 7790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645894441"
variation 7794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388570987"
variation 7795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645894524"
variation 7799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011886579"
variation 7800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1325493005"
variation 7807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1033313595"
variation 7808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218020464"
variation 7814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023742547"
variation 7816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:906099748"
variation 7819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:896245769"
variation 7822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645895127"
variation 7823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013363402"
variation 7826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645895229"
variation 7827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1353691617"
variation 7829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000435153"
variation 7830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:529304195"
variation 7831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542691451"
variation 7833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645895540"
variation 7836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645895647"
variation 7836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:988939718"
variation 7840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:979226030"
variation 7841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018993608"
variation 7845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645895806"
variation 7847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645895843"
variation 7849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1183272091"
variation 7854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1032227537"
variation 7855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:11800878"
variation 7858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:367583172"
variation 7859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753609764"
variation 7860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465046339"
variation 7862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645896209"
variation 7864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329223357"
variation 7867..7869
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1645896334"
variation 7867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645896294"
variation 7877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645896399"
variation 7878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378916834"
variation 7879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:190765482"
variation 7881..7884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1645896590"
variation 7881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1311690893"
variation 7882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:984738697"
variation 7884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729640"
variation 7890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:944691489"
variation 7899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729643"
variation 7900..7902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aga"
/db_xref="dbSNP:1256497507"
variation 7900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1487758792"
variation 7901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148729650"
variation 7904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645897182"
variation 7906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729652"
variation 7913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645897231"
variation 7914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:976189008"
variation 7916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645897326"
variation 7921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1190800512"
variation 7924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:115528846"
variation 7925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197366841"
variation 7927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1260527645"
variation 7932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:551808585"
variation 7933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1200272100"
variation 7935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645897780"
variation 7938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897836"
variation 7941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645897877"
variation 7944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897924"
variation 7947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897970"
variation 7949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254452984"
variation 7951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425796858"
variation 7952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778783444"
variation 7963..7967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aca"
/replace="acaca"
/db_xref="dbSNP:1423093406"
variation 7964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645898281"
variation 7965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:940472965"
variation 7969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1476877414"
variation 7970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645898453"
variation 7972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049227178"
variation 7973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1402407879"
variation 7980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:909460062"
variation 7981..7982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1557630020"
variation 7981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1302059480"
variation 7982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1571387308"
variation 7983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645898841"
variation 7984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645898886"
variation 7987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:147293577"
variation 7988..7990
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1397482627"
variation 7988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645898996"
variation 7994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645899069"
variation 7996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645899120"
variation 7997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645899171"
variation 7998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:938255812"
variation 8003
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:11263838"
variation 8005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645899415"
variation 8006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645899471"
variation 8007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1216218597"
variation 8010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645899572"
variation 8011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:663163"
variation 8012..8013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttata"
/db_xref="dbSNP:1645899747"
variation 8013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645899797"
variation 8016..8018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645899845"
variation 8018..8019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:1013199093"
variation 8021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1042160042"
variation 8027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645900020"
variation 8033..8035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1645900073"
variation 8033..8034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:796743131"
variation 8038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557630078"
variation 8043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900249"
variation 8045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1044725499"
variation 8046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645900359"
variation 8048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:902232968"
variation 8049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557630092"
variation 8059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645900525"
variation 8063..8067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1645900560"
variation 8065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376232788"
variation 8066..8077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagagaa"
/replace="aagagaagagaa"
/db_xref="dbSNP:1424350327"
variation 8069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900712"
variation 8070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000663554"
variation 8075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900811"
variation 8081
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1032148243"
variation 8082..8083
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gt"
/db_xref="dbSNP:1645900894"
variation 8084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900937"
variation 8085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729767"
variation 8086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:34764544"
variation 8087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729770"
variation 8088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:903552001"
variation 8090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1000404100"
variation 8093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313153284"
variation 8099..8101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:1006832383"
variation 8106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:781125965"
variation 8110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645901266"
variation 8116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397696222"
variation 8117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748441732"
variation 8118..8122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:966105029"
variation 8118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:892052895"
variation 8123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645901541"
variation 8129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1342494143"
variation 8137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1314362355"
variation 8140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645901702"
variation 8144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:919342755"
variation 8145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645901799"
variation 8152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645901848"
variation 8159
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010329201"
variation 8162..8164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1557630174"
variation 8164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1215065727"
variation 8165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:769882762"
variation 8167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387463"
variation 8168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:574185625"
variation 8169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1264075715"
variation 8179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:975260157"
variation 8181..8187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttgttt"
/db_xref="dbSNP:1645902274"
variation 8184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:538411096"
variation 8187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:773731413"
variation 8188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951987747"
variation 8189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729816"
variation 8190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645902459"
variation 8191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1280795884"
variation 8192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729822"
variation 8196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645902565"
variation 8197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729825"
variation 8202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1265144990"
variation 8203..8222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtaggagaagaaatcagagt"
/replace="gtaggagaagaaatcagagtgtaggagaagaaatcagagt"
/db_xref="dbSNP:1553157891"
variation 8207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645902976"
variation 8215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487736618"
variation 8218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903083"
variation 8219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749626639"
variation 8221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1417491401"
variation 8221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:938167185"
variation 8222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645903330"
variation 8223..8230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agaag"
/replace="agaagaag"
/db_xref="dbSNP:1160082662"
variation 8223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645903375"
variation 8229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1345332379"
variation 8232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645903513"
variation 8234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1214054853"
variation 8242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645903616"
variation 8246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:907765237"
variation 8250..8256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaca"
/replace="aacaaca"
/db_xref="dbSNP:1456950828"
variation 8251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903841"
variation 8254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903885"
variation 8255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645903931"
variation 8258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729859"
variation 8261..8262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:371771654"
variation 8264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571387555"
variation 8265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904086"
variation 8268..8273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1645904193"
variation 8268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645904133"
variation 8270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:556310027"
variation 8278..8279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1264683629"
variation 8279..8281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148729868"
variation 8279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904356"
variation 8281..8289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/db_xref="dbSNP:557690955"
variation 8284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:577932548"
variation 8285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904533"
variation 8287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187611390"
variation 8288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1267197074"
variation 8289..8291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1491398912"
variation 8289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645904691"
variation 8290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:375747906"
variation 8290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431961690"
variation 8291..8297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgtgt"
/replace="tgtgtgt"
/db_xref="dbSNP:949060752"
variation 8292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771565242"
variation 8293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645905040"
variation 8294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1396098897"
variation 8296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419295127"
variation 8297..8306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="ttttaccttt"
/db_xref="dbSNP:1645905198"
variation 8301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645905238"
variation 8303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1042002877"
variation 8309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645905349"
variation 8310
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286980669"
variation 8311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321236834"
variation 8315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645905480"
variation 8323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645905516"
variation 8325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219505196"
variation 8326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571387653"
variation 8328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1267249623"
variation 8330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:369684987"
variation 8335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645905767"
variation 8336..8339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1194112655"
variation 8339..8341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1237414549"
variation 8339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645905861"
variation 8342..8353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gacttacttacg"
/db_xref="dbSNP:1645905983"
variation 8343..8352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="acttac"
/replace="acttacttac"
/db_xref="dbSNP:750086957"
variation 8343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906029"
variation 8346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:917773706"
variation 8347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645906224"
variation 8347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906185"
variation 8351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1362524771"
variation 8352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645906455"
variation 8352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:61555210"
variation 8353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293016194"
variation 8354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774945280"
variation 8364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045258462"
variation 8373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1351045545"
variation 8377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645906718"
variation 8378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387722"
variation 8379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565480687"
variation 8380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:182177708"
variation 8384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331242413"
variation 8391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906985"
variation 8393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:572003492"
variation 8398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1398619650"
variation 8401..8404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:754918941"
variation 8403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280462375"
variation 8407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:936305098"
variation 8410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226766659"
variation 8412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1052060548"
variation 8420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1352780824"
variation 8424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:892022079"
variation 8425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314948396"
variation 8428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:542039100"
variation 8430..8435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cac"
/replace="caccac"
/db_xref="dbSNP:1645907567"
variation 8431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645907624"
variation 8432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645907679"
variation 8437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645907731"
variation 8438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571387811"
variation 8444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040534105"
variation 8447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902042514"
variation 8450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645907910"
variation 8458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645907960"
variation 8460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908010"
variation 8462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387839"
variation 8466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645908075"
variation 8468..8473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aataaa"
/db_xref="dbSNP:1317146102"
variation 8471..8479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaac"
/replace="aaacaaaac"
/db_xref="dbSNP:997523767"
variation 8475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767123720"
variation 8478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387863"
variation 8483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387867"
variation 8488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645908405"
variation 8490..8497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tcctagcc"
/db_xref="dbSNP:1645908448"
variation 8496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908497"
variation 8499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatatta"
/db_xref="dbSNP:1645908602"
variation 8499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029459149"
variation 8505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387884"
variation 8506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774834541"
variation 8515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908777"
variation 8516..8517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645908887"
variation 8516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908816"
variation 8517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233198421"
variation 8518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645908978"
variation 8519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645909028"
variation 8521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730012"
variation 8526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909071"
variation 8532..8537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tag"
/replace="tagtag"
/db_xref="dbSNP:1645909107"
variation 8536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909150"
variation 8544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762839218"
variation 8545..8553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tattt"
/replace="tatttattt"
/db_xref="dbSNP:1179746891"
variation 8546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909344"
variation 8550..8551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="at"
/replace="ataat"
/db_xref="dbSNP:1263195438"
variation 8555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645909441"
variation 8556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475235403"
variation 8557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645909532"
variation 8558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909578"
variation 8559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909620"
variation 8561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006202972"
variation 8564..8570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctt"
/replace="tcttctt"
/db_xref="dbSNP:1170643933"
variation 8568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645909760"
variation 8569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387944"
variation 8572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422145745"
variation 8579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:375451995"
variation 8584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645909930"
variation 8598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1014957927"
variation 8601..8605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tat"
/replace="tatat"
/db_xref="dbSNP:909283444"
variation 8602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:961944436"
variation 8607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1196097951"
variation 8608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645910202"
variation 8608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645910166"
variation 8611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645910251"
variation 8614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253996075"
variation 8616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:992521972"
variation 8617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910417"
variation 8623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910458"
variation 8624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910515"
variation 8626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:991359427"
variation 8627..8628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1645910622"
variation 8629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:917757843"
variation 8630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:969590169"
variation 8632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218063131"
variation 8635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439531364"
variation 8640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645911357"
variation 8644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557630522"
variation 8645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980636381"
variation 8646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1316018304"
variation 8650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645911565"
variation 8651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:925003738"
variation 8654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645911655"
variation 8655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176998308"
variation 8660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645911744"
variation 8661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:936440744"
variation 8662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645911840"
variation 8667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645911885"
variation 8670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216184695"
variation 8678..8679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645911975"
variation 8680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1273527169"
variation 8681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645912066"
variation 8682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645912107"
variation 8684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645912153"
variation 8688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1441615560"
variation 8689..8692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1207643714"
variation 8690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:918185284"
variation 8691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485770805"
variation 8697
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1192327329"
variation 8700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:949611226"
variation 8704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1479091509"
variation 8705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977746888"
variation 8706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645912933"
variation 8707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1168993980"
variation 8711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1401515206"
variation 8716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645913138"
variation 8717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571388106"
variation 8719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645913242"
variation 8725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:923632669"
variation 8728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1178558224"
variation 8732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645913385"
variation 8737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:185191307"
variation 8738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1348252754"
variation 8743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645913563"
variation 8746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645913592"
variation 8751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1459362590"
variation 8759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:913598862"
variation 8763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296441105"
variation 8766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255355390"
variation 8768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1053574204"
variation 8777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645914337"
variation 8785..8786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tacatta"
/db_xref="dbSNP:1645914441"
variation 8785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645914395"
variation 8786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:946293747"
variation 8787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cattatc"
/db_xref="dbSNP:1645914549"
variation 8789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645914597"
variation 8793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730137"
variation 8796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645914643"
variation 8797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571388164"
variation 8801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344082505"
variation 8803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041064870"
variation 8804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645914949"
variation 8812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148730146"
variation 8813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:902102576"
variation 8818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1348171002"
variation 8821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041242279"
variation 8826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260498192"
variation 8832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645915204"
variation 8836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488977942"
variation 8838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:996721403"
variation 8840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1246608446"
variation 8846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645915401"
variation 8852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1050633707"
variation 8856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645915497"
variation 8857..8863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tggt"
/replace="tggtggt"
/db_xref="dbSNP:1645915544"
variation 8859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:372984594"
variation 8862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1193311041"
variation 8863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1311204694"
variation 8867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645915762"
variation 8872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557630747"
variation 8874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571388234"
variation 8877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:760427087"
variation 8885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1025546631"
variation 8888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419395934"
variation 8890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:561018703"
variation 8897..8898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645916191"
variation 8899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1362587577"
variation 8907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916291"
variation 8909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645916333"
variation 8915..8925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttgttatttct"
/db_xref="dbSNP:886475700"
variation 8919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763687211"
variation 8921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016353899"
variation 8926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:531279755"
variation 8938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:959688040"
variation 8947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916654"
variation 8948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645916697"
variation 8957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916781"
variation 8963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:962078524"
variation 8964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:868779519"
variation 8966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917001"
variation 8968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571388284"
variation 8969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1239056012"
variation 8971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645917148"
variation 8972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917198"
variation 8974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025076280"
variation 8976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1287091044"
variation 8983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917377"
variation 8984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917438"
variation 8988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917492"
variation 8989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917535"
variation 8995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1323048375"
variation 8996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917625"
variation 8998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917669"
variation 9002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917718"
variation 9006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917769"
variation 9009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917834"
variation 9010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013592131"
variation 9013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025276256"
variation 9016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645918010"
variation 9018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645918050"
variation 9020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645918116"
variation 9022..9028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttcctct"
/db_xref="dbSNP:1645918165"
variation 9027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:969343335"
variation 9028..9043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tggaggccaagtgttg"
/db_xref="dbSNP:531097561"
variation 9030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645918352"
variation 9037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1288469844"
variation 9043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457711634"
variation 9048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:924187437"
variation 9049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:936380126"
variation 9051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645918640"
variation 9053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439445401"
variation 9054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980987145"
variation 9059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:188289018"
variation 9060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645918843"
variation 9061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645918909"
variation 9063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1470605990"
variation 9068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:375321641"
variation 9076..9078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1234983001"
variation 9078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645919134"
variation 9079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645919188"
variation 9080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1403601243"
variation 9085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1327825640"
variation 9086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:910981528"
variation 9087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645919439"
variation 9088..9099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agccagccagcc"
/replace="agccagccagccagcc"
/db_xref="dbSNP:1181550295"
variation 9089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1411707007"
variation 9091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557630912"
variation 9094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:957770044"
variation 9096
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645919705"
variation 9098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:942413140"
variation 9100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337188989"
variation 9102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1040900849"
variation 9105..9110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1645919966"
variation 9107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1283098745"
variation 9108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645920093"
variation 9112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730297"
variation 9113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1353624234"
variation 9118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1476268804"
variation 9122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:901028900"
variation 9126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1457678064"
variation 9136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645920365"
variation 9138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197180703"
variation 9146..9150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ga"
/replace="gaaga"
/replace="gaagaaga"
/db_xref="dbSNP:140864"
variation 9146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645920503"
variation 9147..9148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:34307163"
variation 9148..9151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:35814364"
variation 9148..9149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="ga"
/db_xref="dbSNP:869263455"
variation 9148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:201441860"
variation 9152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:550020187"
variation 9154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1438623533"
variation 9155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1047055048"
variation 9156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:888328294"
variation 9164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921198"
variation 9165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730337"
variation 9169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1006231276"
variation 9177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921275"
variation 9179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645921336"
variation 9182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181116037"
variation 9184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921436"
variation 9186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1167074194"
variation 9187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333074315"
variation 9189..9190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645921609"
variation 9190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645921660"
variation 9191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1016651001"
variation 9192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645921779"
variation 9194..9196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="ata"
/db_xref="dbSNP:555724154"
variation 9194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756987293"
variation 9195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645921958"
variation 9200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571388519"
variation 9202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557631025"
variation 9206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1012769642"
variation 9207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730355"
variation 9208..9209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:2148730356"
variation 9209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987884081"
variation 9210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1391670109"
variation 9216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550717064"
variation 9217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025002346"
variation 9223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333064396"
variation 9224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730365"
variation 9225..9230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaagaa"
/db_xref="dbSNP:1645922504"
variation 9225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:970904019"
variation 9227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730371"
variation 9228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1338243940"
variation 9233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148730372"
variation 9234..9238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agcag"
/db_xref="dbSNP:978227204"
variation 9236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645922642"
variation 9238..9242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1557631060"
variation 9239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645922737"
variation 9241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:115162190"
variation 9242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557631064"
variation 9243..9244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1557631076"
variation 9243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1557631071"
variation 9245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645922998"
variation 9246..9255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggagga"
/replace="aggaggagga"
/db_xref="dbSNP:1645923047"
variation 9253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1317848508"
variation 9254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645923174"
variation 9256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:958496568"
variation 9258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1253510461"
variation 9260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:943662728"
variation 9261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:547713014"
variation 9262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233292745"
variation 9269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923581"
variation 9272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923620"
variation 9273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645923674"
variation 9275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:976459592"
variation 9276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645923769"
variation 9277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923803"
variation 9278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1188783541"
variation 9284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923894"
variation 9285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:369522490"
variation 9290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923987"
variation 9295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:923494918"
variation 9296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1477460562"
variation 9297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1317790452"
variation 9300..9301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tg"
/db_xref="dbSNP:1645924240"
variation 9300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645924190"
variation 9302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:369678188"
variation 9304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645924382"
variation 9304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645924334"
variation 9305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750425416"
variation 9307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:932276397"
variation 9311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1399655616"
variation 9317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645924654"
variation 9317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645924616"
variation 9319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:910853352"
variation 9324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730433"
variation 9325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:536927360"
variation 9327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:566794455"
variation 9330..9331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:1645924872"
variation 9331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645924925"
variation 9338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645924976"
variation 9339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339261076"
variation 9341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1209679291"
variation 9342..9348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aagttaa"
/db_xref="dbSNP:1645925240"
variation 9342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:942092258"
variation 9346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645925297"
variation 9347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925351"
variation 9351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1233011649"
variation 9352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645925450"
variation 9357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1235883822"
variation 9361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557631171"
variation 9364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254587948"
variation 9365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:963726070"
variation 9366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925755"
variation 9367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1211791579"
variation 9369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925844"
variation 9370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645925905"
variation 9373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:976524051"
variation 9374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1285469149"
variation 9376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645926152"
variation 9377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487344556"
variation 9380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:922346450"
variation 9383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:929800092"
variation 9386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:527669622"
variation 9387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549237039"
variation 9389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197914771"
variation 9391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730478"
variation 9394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1392976578"
variation 9396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1436265888"
variation 9408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173872939"
variation 9409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1359389680"
variation 9415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450967468"
variation 9416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1290064103"
variation 9417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781379128"
variation 9418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909814849"
variation 9420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299657367"
variation 9422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1373626613"
variation 9427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645927187"
variation 9430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:185858553"
variation 9446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1055697473"
variation 9448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661621"
variation 9449..9458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tccttc"
/replace="tccttccttc"
/db_xref="dbSNP:1218081256"
variation 9449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645927931"
variation 9450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1261319218"
variation 9452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557631281"
variation 9455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:905089140"
variation 9459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645928288"
variation 9461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1476784105"
variation 9463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928392"
variation 9464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1209153186"
variation 9465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1002154199"
variation 9469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1250980066"
variation 9471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148730511"
variation 9488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730512"
variation 9495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571388910"
variation 9506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928633"
variation 9510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928670"
variation 9512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928707"
variation 9516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1169625706"
variation 9517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557631302"
variation 9521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928858"
variation 9522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928897"
variation 9523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:755404281"
variation 9526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379326027"
variation 9529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566124661"
variation 9535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:906587405"
variation 9536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645929464"
variation 9540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:957905671"
variation 9541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:987936386"
variation 9544..9548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tct"
/replace="tctct"
/db_xref="dbSNP:1324462378"
variation 9545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645929665"
variation 9548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397188131"
variation 9549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645929760"
variation 9551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1442134509"
variation 9553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308942244"
variation 9555..9566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agcagaccccag"
/db_xref="dbSNP:1645929927"
variation 9557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571388998"
variation 9561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1020633272"
variation 9562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645930068"
variation 9563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:537918276"
variation 9564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011597209"
variation 9566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645930333"
variation 9568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:976807461"
variation 9570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415042054"
variation 9574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556344781"
variation 9576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645930529"
variation 9577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645930579"
variation 9579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645930630"
variation 9581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645930675"
variation 9592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645930721"
variation 9599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:920968850"
variation 9600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:571457484"
variation 9601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1237268495"
variation 9603..9606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1479460493"
variation 9608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1178560312"
variation 9611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645931081"
variation 9613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1408159161"
variation 9615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422693027"
variation 9617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778071525"
variation 9624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:538991257"
variation 9627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645931359"
variation 9629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1420696197"
variation 9636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1462365726"
variation 9637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337824283"
variation 9639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:976378557"
variation 9645..9647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1353108129"
variation 9646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645931650"
variation 9648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:76228984"
variation 9657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645931822"
variation 9659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730618"
variation 9660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:909469542"
variation 9662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982632384"
variation 9663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932004"
variation 9668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571389116"
variation 9669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932124"
variation 9670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413035460"
variation 9672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932222"
variation 9673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909731645"
variation 9675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645932343"
variation 9678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932401"
variation 9681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1336859435"
variation 9683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645932525"
variation 9684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941191309"
variation 9689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:571976877"
variation 9691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:542631707"
variation 9692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:554236559"
variation 9694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645932802"
variation 9698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218947869"
variation 9699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1276981531"
variation 9710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206225660"
variation 9711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:897878642"
variation 9712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:949518256"
variation 9713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:76697094"
variation 9715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1185171901"
variation 9716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1258936672"
variation 9719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645933368"
variation 9720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475855058"
variation 9721..9722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1170589272"
variation 9722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148730672"
variation 9722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645933797"
variation 9723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417868148"
variation 9724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389218"
variation 9728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:905225551"
variation 9734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002072883"
variation 9743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487381167"
variation 9745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934129"
variation 9746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1171506019"
variation 9747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934252"
variation 9749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934296"
variation 9750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:191561832"
variation 9753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:565124454"
variation 9756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934495"
variation 9765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1356152831"
variation 9767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934617"
variation 9773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1242561591"
variation 9774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774855156"
variation 9775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1020767569"
variation 9776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934928"
variation 9788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396694608"
variation 9789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:965488511"
variation 9790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:999541063"
variation 9791..9792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1273371065"
variation 9791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052452213"
variation 9794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1208267090"
variation 9796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645935320"
variation 9797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281928751"
variation 9799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645935416"
variation 9804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:997980288"
variation 9812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645935522"
variation 9820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:144839878"
variation 9822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645935647"
variation 9828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:953699800"
variation 9836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777902193"
variation 9843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645935888"
variation 9844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389337"
variation 9845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:909436967"
variation 9849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645936024"
variation 9855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730732"
variation 9856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936070"
variation 9859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:746430497"
variation 9861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:972205965"
variation 9863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645936224"
variation 9864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1424826706"
variation 9866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1433155202"
variation 9870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645936346"
variation 9871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936384"
variation 9876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299430009"
variation 9883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936481"
variation 9888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:964296465"
variation 9889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645936637"
variation 9889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:541373139"
variation 9890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:567471178"
variation 9891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046513851"
variation 9894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645936800"
variation 9896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645936844"
variation 9897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:926702492"
variation 9899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936923"
variation 9900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343372432"
variation 9903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:937979601"
variation 9905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645937054"
variation 9907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937090"
variation 9909..9917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ta"
/replace="tatatcata"
/db_xref="dbSNP:1645937128"
variation 9910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:772438156"
variation 9914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273415719"
variation 9915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937280"
variation 9917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951009828"
variation 9920..9921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645937390"
variation 9921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369976515"
variation 9922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937485"
variation 9924..9929
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1373713883"
variation 9929
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:183777566"
variation 9934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1235279035"
variation 9936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:893706036"
variation 9937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938031"
variation 9940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:879287028"
variation 9941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645938135"
variation 9942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645938178"
variation 9944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938223"
variation 9945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571389448"
variation 9946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376685024"
variation 9947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1285655950"
variation 9948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557631682"
variation 9951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1009468975"
variation 9954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775089595"
variation 9956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645938531"
variation 9957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938581"
variation 9958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351784476"
variation 9960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645938762"
variation 9962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982558756"
variation 9963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042607221"
variation 9964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938928"
variation 9967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645938968"
variation 9969..9975
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgtt"
/replace="tgttgtt"
/db_xref="dbSNP:1449247484"
variation 9973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1450922295"
variation 9983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645939126"
variation 9986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1246555874"
variation 9987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645939234"
variation 9989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1452924763"
variation 9991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:186821250"
variation 9993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645939409"
variation 9995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:147529833"
variation 9997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571389520"
variation 9999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645939650"
variation 10005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645939724"
variation 10008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:901047433"
variation 10009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645940116"
variation 10010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645940165"
variation 10011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016676335"
variation 10012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571389534"
variation 10016..10021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1156913272"
variation 10017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1454602683"
variation 10022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1041723286"
variation 10025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402447345"
variation 10026..10029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1378038090"
variation 10026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:902424416"
variation 10028..10029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1455044342"
variation 10028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393521931"
variation 10029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1237809139"
variation 10030..10048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttttttt"
/replace="ttttttttttttt"
/replace="ttttttttttttttt"
/replace="tttttttttttttttt"
/replace="ttttttttttttttttt"
/replace="tttttttttttttttttt"
/replace="ttttttttttttttttttt"
/replace="tttttttttttttttttttt"
/replace="ttttttttttttttttttttt"
/replace="tttttttttttttttttttttt"
/replace="ttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttttttttttttttttttttttt
ttttttt"
/db_xref="dbSNP:rs56299314"
variation 10030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998430886"
variation 10031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1389444371"
variation 10032..10033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1253963572"
variation 10032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:991298321"
variation 10033..10034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645941577"
variation 10033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941528"
variation 10034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941619"
variation 10035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1305799231"
variation 10036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437526799"
variation 10037..10038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645941836"
variation 10037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1324541265"
variation 10038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941887"
variation 10040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1373639324"
variation 10043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442010437"
variation 10047..10048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645942085"
variation 10048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:915821854"
variation 10049..10050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1459750847"
variation 10049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1334151702"
variation 10050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645942678"
variation 10051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645942899"
variation 10051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1241485762"
variation 10052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148730886"
variation 10056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730888"
variation 10058..10066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ataata"
/replace="ataataata"
/db_xref="dbSNP:1390527072"
variation 10067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1326405001"
variation 10069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730897"
variation 10074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571389709"
variation 10075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571389716"
variation 10077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730909"
variation 10080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:192178564"
variation 10085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:76010229"
variation 10086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292086954"
variation 10088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148730920"
variation 10093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645943470"
variation 10094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333357254"
variation 10096
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:368787742"
variation 10097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645943653"
variation 10100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274276173"
variation 10101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1339109894"
variation 10107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274900715"
variation 10111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:571547232"
variation 10114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645943980"
variation 10120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389776"
variation 10122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438572134"
variation 10127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557631973"
variation 10129..10133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tc"
/replace="tcctc"
/db_xref="dbSNP:1645944220"
variation 10129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468870902"
variation 10130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:927991002"
variation 10131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944341"
variation 10134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645944393"
variation 10137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645944429"
variation 10139..10143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aga"
/replace="agaga"
/db_xref="dbSNP:2148730948"
variation 10142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1197725041"
variation 10144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730952"
variation 10146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571389812"
variation 10147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953944035"
variation 10152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1236172183"
variation 10153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645944711"
variation 10154..10157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:935320290"
variation 10156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944817"
variation 10157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944852"
variation 10161
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944915"
variation 10162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005197104"
variation 10163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1418357887"
variation 10166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645945036"
variation 10172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052981048"
variation 10174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1165885221"
variation 10179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645945167"
variation 10181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:893885209"
variation 10185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:538830586"
variation 10188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:554046305"
variation 10191..10195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatga"
/db_xref="dbSNP:1039846959"
variation 10193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417210514"
variation 10196..10202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gag"
/replace="gagtgag"
/db_xref="dbSNP:1166468590"
variation 10196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645945523"
variation 10205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397247151"
variation 10207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1016631003"
variation 10212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:79355955"
variation 10217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:374567306"
variation 10219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:998463302"
variation 10220..10228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtttg"
/replace="gtttgtttg"
/db_xref="dbSNP:1645945883"
variation 10222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1253380792"
variation 10223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645945999"
variation 10224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:972340698"
variation 10233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1210421637"
variation 10234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278367992"
variation 10238..10242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aagta"
/db_xref="dbSNP:1645946188"
variation 10239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1486676421"
variation 10246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730998"
variation 10251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029907759"
variation 10252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1256800555"
variation 10255..10258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tttt"
/db_xref="dbSNP:1427805956"
variation 10260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1190759460"
variation 10262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331051161"
variation 10266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:886809352"
variation 10267..10269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148731008"
variation 10268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1449770932"
variation 10271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645946697"
variation 10272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571389968"
variation 10278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1172599437"
variation 10279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537611630"
variation 10281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1393337895"
variation 10284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1017098420"
variation 10286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1329859133"
variation 10287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:962457507"
variation 10297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1298262217"
variation 10298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645947152"
variation 10302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:970880807"
variation 10303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:796216640"
variation 10306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991745125"
variation 10307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022772857"
variation 10312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:926698779"
variation 10313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1211717696"
variation 10316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765055734"
variation 10320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645947544"
variation 10321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231469789"
variation 10325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645947772"
variation 10328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:938122072"
variation 10330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645947863"
variation 10331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645947901"
variation 10332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:536504767"
variation 10337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645948019"
variation 10338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645948072"
variation 10341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1263636608"
variation 10345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:750161490"
variation 10347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645948761"
variation 10351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645948795"
variation 10352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1192727380"
variation 10354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645948898"
variation 10356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557632206"
variation 10359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645948999"
variation 10365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645949043"
variation 10366..10372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aagaaaa"
/db_xref="dbSNP:1392914826"
variation 10366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645949105"
variation 10373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645949205"
variation 10374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:981350706"
variation 10375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1455253259"
variation 10376..10384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tcat"
/replace="tcatttcat"
/db_xref="dbSNP:924520841"
variation 10380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:915277531"
variation 10382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645949519"
variation 10383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1452338087"
variation 10385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645949661"
variation 10386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217983159"
variation 10391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291110926"
variation 10394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645949803"
variation 10396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:536507609"
variation 10399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1389902328"
variation 10400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440655487"
variation 10403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645949979"
variation 10404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:555810167"
variation 10409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042270233"
variation 10417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950154"
variation 10419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:901095268"
variation 10424..10429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttaatt"
/db_xref="dbSNP:1306471992"
variation 10425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998002982"
variation 10435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:554734378"
variation 10437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645950403"
variation 10438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262448321"
variation 10439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:889519470"
variation 10442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950528"
variation 10444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:761407670"
variation 10446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1005332944"
variation 10447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645950670"
variation 10448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465261319"
variation 10449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:574671804"
variation 10454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950821"
variation 10458..10459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ca"
/db_xref="dbSNP:765710979"
variation 10458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:554554773"
variation 10467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:575943703"
variation 10469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645951006"
variation 10471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:543584812"
variation 10473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440347734"
variation 10477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645951162"
variation 10479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249253610"
variation 10482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1416767433"
variation 10484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:946799865"
variation 10485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040176474"
variation 10486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645951426"
variation 10487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1571390306"
variation 10490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:766182338"
variation 10493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645951578"
variation 10496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645951627"
variation 10502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:994240347"
variation 10506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1026532078"
variation 10507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:564774699"
variation 10508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645951847"
variation 10514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:934140536"
variation 10515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:532140374"
variation 10516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645952015"
variation 10517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397122822"
variation 10520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752823385"
variation 10523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645952175"
variation 10529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475802643"
variation 10532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769579976"
variation 10534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051385703"
variation 10538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1387279727"
variation 10539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:887318250"
variation 10541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:577137923"
variation 10547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731147"
variation 10549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645952594"
variation 10551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571390376"
variation 10552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645952695"
variation 10554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645952755"
variation 10558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571390379"
variation 10566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1329790878"
variation 10567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232591929"
variation 10569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645952994"
variation 10570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016571419"
variation 10571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541247710"
variation 10574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1221909151"
variation 10577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953212"
variation 10580..10583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1250436182"
variation 10581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170656511"
variation 10586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953349"
variation 10589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012690951"
variation 10592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731173"
variation 10599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1034292694"
variation 10601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023122358"
variation 10603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953543"
variation 10604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1475198673"
variation 10606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645953620"
variation 10608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:959441747"
variation 10609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645953732"
variation 10613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:971236523"
variation 10621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406344392"
variation 10622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571390465"
variation 10623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731193"
variation 10627..10630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1170144354"
variation 10627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756201441"
variation 10628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571390483"
variation 10629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645954035"
variation 10632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463669362"
variation 10636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308776284"
variation 10637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645954194"
variation 10638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645954239"
variation 10642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:797000"
variation 10644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1413202362"
variation 10645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1314800058"
variation 10648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1356235775"
variation 10649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645954749"
variation 10649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291336086"
variation 10650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399312246"
variation 10653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1381191391"
variation 10656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645954902"
variation 10658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293434777"
variation 10662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645955000"
variation 10678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955058"
variation 10680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1271937511"
variation 10687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1305415314"
variation 10692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955199"
variation 10693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:149973488"
variation 10694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645955307"
variation 10696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1274815717"
variation 10702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978512280"
variation 10706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1485047376"
variation 10710..10715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atc"
/replace="atcatc"
/db_xref="dbSNP:988567911"
variation 10712..10719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="catc"
/replace="catccatc"
/db_xref="dbSNP:1645955559"
variation 10713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955621"
variation 10714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645955670"
variation 10717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260272129"
variation 10723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148731236"
variation 10724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1473376114"
variation 10727..10728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gc"
/db_xref="dbSNP:1645955865"
variation 10729..10736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tta"
/replace="ttagatta"
/db_xref="dbSNP:915270251"
variation 10731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1417796906"
variation 10739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731249"
variation 10741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956028"
variation 10742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956083"
variation 10745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:922523004"
variation 10755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:933923210"
variation 10756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049564838"
variation 10759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1255212265"
variation 10764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571390632"
variation 10767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1345239585"
variation 10772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956465"
variation 10773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1374976353"
variation 10775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645956563"
variation 10777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645956616"
variation 10781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956654"
variation 10789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645956696"
variation 10795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956744"
variation 10798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1432963371"
variation 10804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557632608"
variation 10806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956893"
variation 10809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731274"
variation 10811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645956933"
variation 10812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956974"
variation 10815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:749591113"
variation 10816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957080"
variation 10823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957267"
variation 10824
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314784229"
variation 10834
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541709462"
variation 10837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645957439"
variation 10838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645957482"
variation 10839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360833545"
variation 10842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:889656691"
variation 10843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:975558464"
variation 10845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269434140"
variation 10846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645957713"
variation 10849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:941085179"
variation 10851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957762"
variation 10852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:370987082"
variation 10856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645957861"
variation 10862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557632654"
variation 10863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:561377490"
variation 10864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645958029"
variation 10866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645958078"
variation 10871..10874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1212627138"
variation 10873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645958200"
variation 10875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1230227545"
variation 10882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557632676"
variation 10883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1038086877"
variation 10884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958411"
variation 10890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1297912830"
variation 10892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1346659954"
variation 10893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231450945"
variation 10895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:896914475"
variation 10898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1281771883"
variation 10901..10906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1645958717"
variation 10909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958777"
variation 10914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1257578153"
variation 10916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1215700811"
variation 10921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:531586139"
variation 10922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958969"
variation 10924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757525458"
variation 10925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487708249"
variation 10931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1487039969"
variation 10939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571390780"
variation 10941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:72902981"
variation 10944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1260188111"
variation 10946..10954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttttatatt"
/db_xref="dbSNP:934150347"
variation 10946..10949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645959570"
variation 10951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645959687"
variation 10955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645959736"
variation 10956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1175609979"
variation 10957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425938053"
variation 10963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645959918"
variation 10966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051230848"
variation 10967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645960017"
variation 10975
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317511757"
variation 10981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:906771930"
variation 10983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1040157330"
variation 10986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731364"
variation 10987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1437053986"
variation 10991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:940262733"
variation 10994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645960401"
variation 10995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1171516285"
variation 11000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1231609646"
variation 11004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645960576"
variation 11006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:183246331"
variation 11008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148731378"
variation 11009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1033807276"
variation 11011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645960749"
variation 11016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645960818"
variation 11018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645960867"
variation 11020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645960923"
variation 11021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1223766443"
variation 11022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:959493286"
variation 11024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282794742"
variation 11027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1331785007"
variation 11031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565061414"
variation 11032..11035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggtg"
/replace="ggtggtg"
/db_xref="dbSNP:1433070917"
variation 11037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961260"
variation 11041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961306"
variation 11047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731402"
variation 11048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1252699110"
variation 11054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:989617154"
variation 11056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1324155466"
variation 11057..11059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:35360401"
variation 11060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022309525"
variation 11061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247403885"
variation 11062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645961677"
variation 11063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645961719"
variation 11064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1469669349"
variation 11065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645961803"
variation 11067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:966786785"
variation 11069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645961931"
variation 11071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961981"
variation 11073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:978102549"
variation 11074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458699622"
variation 11076..11088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcagttgctctc"
/replace="ctcagttgctctcagttgctctc"
/db_xref="dbSNP:932315942"
variation 11078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772665781"
variation 11079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645962253"
variation 11082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1438311565"
variation 11086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645962360"
variation 11089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331275123"
variation 11091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645962442"
variation 11092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731442"
variation 11096
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440877349"
variation 11099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645962519"
variation 11103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645962556"
variation 11104..11108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttctt"
/db_xref="dbSNP:1645962608"
variation 11106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645962698"
variation 11106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:933913300"
variation 11111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1277194365"
variation 11112..11113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ta"
/replace="tata"
/db_xref="dbSNP:1645962827"
variation 11112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1352880263"
variation 11115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229529982"
variation 11116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645962916"
variation 11118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:985818181"
variation 11121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780359581"
variation 11124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645963039"
variation 11127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:532437523"
variation 11128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1333104450"
variation 11129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941138142"
variation 11131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963237"
variation 11134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:547982368"
variation 11137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963342"
variation 11140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645963392"
variation 11142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1290902326"
variation 11143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:373686806"
variation 11146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179771257"
variation 11148
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963572"
variation 11150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963634"
variation 11151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1254058861"
variation 11152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1473570625"
variation 11153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645963769"
variation 11154..11160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aata"
/replace="aataata"
/db_xref="dbSNP:1645963806"
variation 11155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:929744265"
variation 11158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1368577431"
variation 11162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645963949"
variation 11163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964002"
variation 11165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342960689"
variation 11166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1236022849"
variation 11168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391071"
variation 11170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645964181"
variation 11171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955855642"
variation 11172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964273"
variation 11176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280679964"
variation 11177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391096"
variation 11179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011523316"
variation 11181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964460"
variation 11184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964497"
variation 11188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566097843"
variation 11192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351790848"
variation 11194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645964638"
variation 11196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964690"
variation 11198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964746"
variation 11202..11212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgacttactg"
/db_xref="dbSNP:1557632990"
variation 11207..11209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tta"
/db_xref="dbSNP:1411012960"
variation 11209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964884"
variation 11212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964938"
variation 11214
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557632999"
variation 11219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:968116522"
variation 11221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1262009984"
variation 11222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537000935"
variation 11231..11233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1487119334"
variation 11231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645965170"
variation 11235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:548591833"
variation 11236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:569703352"
variation 11237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965386"
variation 11240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955413619"
variation 11244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965488"
variation 11247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965534"
variation 11248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645965587"
variation 11249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001213093"
variation 11250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1276915536"
variation 11251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:751069758"
variation 11252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537024441"
variation 11253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1055271617"
variation 11254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210193915"
variation 11255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645965962"
variation 11258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256753454"
variation 11262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:895417653"
variation 11264..11276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgcactgagtatt"
/replace="tgcactgagtattgcactgagtatt"
/db_xref="dbSNP:1195903376"
variation 11264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1011008122"
variation 11268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:986984923"
variation 11269..11273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgagt"
/db_xref="dbSNP:1645966287"
variation 11272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645966332"
variation 11273..11277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tattt"
/db_xref="dbSNP:1645966383"
variation 11277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368812370"
variation 11287..11288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:768505111"
variation 11289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:908733349"
variation 11299
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1022445034"
variation 11302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940169695"
variation 11303..11304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1429852086"
variation 11303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645966696"
variation 11308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645966780"
variation 11309..11314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="atcttt"
/db_xref="dbSNP:1645966820"
variation 11311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645966871"
variation 11312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645966935"
variation 11319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1038648489"
variation 11322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645967015"
variation 11325..11331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="act"
/replace="acttact"
/db_xref="dbSNP:1439339547"
variation 11326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:920167348"
variation 11327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:558557808"
variation 11331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454227670"
variation 11332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645967251"
variation 11333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1335354894"
variation 11337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645967331"
variation 11338..11341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="at"
/replace="atat"
/db_xref="dbSNP:760214668"
variation 11338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:577028704"
variation 11339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645967498"
variation 11340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645967559"
variation 11344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1292926775"
variation 11346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1233660586"
variation 11348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645967686"
variation 11350..11352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645967724"
variation 11351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747536325"
variation 11355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:534379333"
variation 11368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000050388"
variation 11371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645967961"
variation 11373..11380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttgtt"
/replace="ttgttgtt"
/db_xref="dbSNP:774358868"
variation 11388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645968060"
variation 11390..11393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gt"
/replace="gtgt"
/db_xref="dbSNP:1482267019"
variation 11391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:906981995"
variation 11394..11400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctc"
/replace="ctcactc"
/db_xref="dbSNP:1645968230"
variation 11395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002603071"
variation 11398..11401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1392008923"
variation 11406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442744285"
variation 11409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1029659910"
variation 11413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571391359"
variation 11414..11415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1449640571"
variation 11419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645968581"
variation 11420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172540728"
variation 11424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645968854"
variation 11426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1375424872"
variation 11427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645968957"
variation 11428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:891663260"
variation 11431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645969054"
variation 11432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955516294"
variation 11433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:13374690"
variation 11434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:186500181"
variation 11435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761501941"
variation 11439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021545390"
variation 11442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1366214165"
variation 11445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645969491"
variation 11448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:900384495"
variation 11450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1301418755"
variation 11451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391431"
variation 11453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645969750"
variation 11454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645969790"
variation 11458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313994790"
variation 11459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:962637582"
variation 11461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645969978"
variation 11463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645970022"
variation 11465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:973883790"
variation 11469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148731634"
variation 11470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1256538396"
variation 11471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1349816459"
variation 11475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1308492815"
variation 11480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249913556"
variation 11482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:996864302"
variation 11483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645970400"
variation 11485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645970455"
variation 11486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249649614"
variation 11491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645970856"
variation 11496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542145695"
variation 11497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645970961"
variation 11508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971016"
variation 11509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971074"
variation 11510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:563417423"
variation 11511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:773087620"
variation 11515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971253"
variation 11521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:576054752"
variation 11525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645971355"
variation 11526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645971407"
variation 11529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:543429815"
variation 11530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1215887950"
variation 11533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1176111045"
variation 11534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571391522"
variation 11535..11544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaaaaa"
/replace="aaaaaaaaaa"
/replace="aaaaaaaaaaa"
/db_xref="dbSNP:148090796"
variation 11535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:928413251"
variation 11544..11545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1571391534"
variation 11544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:191452426"
variation 11545..11552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttt"
/db_xref="dbSNP:1015679361"
variation 11545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:182527149"
variation 11546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645972168"
variation 11547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1369938681"
variation 11550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:974606597"
variation 11551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1387455843"
variation 11554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645972514"
variation 11556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645972635"
variation 11557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645972708"
variation 11562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:145217568"
variation 11563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:565342652"
variation 11564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645973107"
variation 11568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980305904"
variation 11569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1043862956"
variation 11573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902717828"
variation 11574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329582447"
variation 11582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645973519"
variation 11584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:999700616"
variation 11585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928334836"
variation 11586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1419816438"
variation 11590..11595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctct"
/replace="ctctct"
/db_xref="dbSNP:1645974053"
variation 11591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1164176522"
variation 11602
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415503827"
variation 11603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645974332"
variation 11606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1471932731"
variation 11608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:938344896"
variation 11614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:376645263"
variation 11615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:188384146"
variation 11616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:548893620"
variation 11620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006870978"
variation 11621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299599273"
variation 11624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731724"
variation 11625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1297748652"
variation 11627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975152"
variation 11630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368752337"
variation 11631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:947249893"
variation 11638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975310"
variation 11639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975356"
variation 11644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:192876785"
variation 11648..11652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cataa"
/replace="cataattccataattccataa"
/db_xref="dbSNP:1645975465"
variation 11651..11664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagccac"
/replace="aagccacaagccac"
/db_xref="dbSNP:369200119"
variation 11651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232464621"
variation 11655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975673"
variation 11657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:996060361"
variation 11658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975778"
variation 11659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975833"
variation 11660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:962606885"
variation 11664..11686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgggcccagcctcttttacctg"
/db_xref="dbSNP:1645975920"
variation 11665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975972"
variation 11667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323198939"
variation 11668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571391707"
variation 11672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1221838658"
variation 11672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1030240996"
variation 11673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645976236"
variation 11674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:891165367"
variation 11675..11678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:2148731754"
variation 11677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:570383674"
variation 11679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645976445"
variation 11680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1475127738"
variation 11681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015678868"
variation 11683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391747"
variation 11690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731770"
variation 11694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571391757"
variation 11695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1437672957"
variation 11705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557633486"
variation 11706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1424657866"
variation 11717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1169982834"
variation 11721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:918514248"
variation 11723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431744049"
variation 11725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1308645978"
variation 11725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951256614"
variation 11726..11727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="agg"
/db_xref="dbSNP:1645977129"
variation 11726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:981312528"
variation 11728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645977184"
variation 11730..11733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1645977241"
variation 11733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300930716"
variation 11735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645977370"
variation 11738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645977428"
variation 11742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381025451"
variation 11745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:928351968"
variation 11756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645977573"
variation 11757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228577338"
variation 11757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645977661"
variation 11758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753949706"
variation 11760
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:937117617"
variation 11761..11764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645977831"
variation 11763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645977865"
variation 11767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1339586279"
variation 11770..11772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1645977959"
variation 11779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645978012"
variation 11780..11781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1645978071"
variation 11789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1229978878"
variation 11790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481089017"
variation 11792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391859"
variation 11793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485670167"
variation 11800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645978364"
variation 11801..11804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1208604089"
variation 11805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391875"
variation 11811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645978528"
variation 11813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239632219"
variation 11816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978639"
variation 11818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645978711"
variation 11824..11827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645978750"
variation 11826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391892"
variation 11830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978883"
variation 11831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978962"
variation 11833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979016"
variation 11836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645979058"
variation 11839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645979099"
variation 11841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1055378139"
variation 11845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187262885"
variation 11846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:914270513"
variation 11847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:946964831"
variation 11855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979475"
variation 11856..11861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1476134044"
variation 11856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645979511"
variation 11865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979626"
variation 11867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1043914988"
variation 11868..11869
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ta"
/db_xref="dbSNP:1645979734"
variation 11873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645979785"
variation 11875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391932"
variation 11876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645979859"
variation 11877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391941"
variation 11880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979951"
variation 11882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645980009"
variation 11884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645980093"
variation 11887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902770990"
variation 11888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027592148"
variation 11890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645980281"
variation 11896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:185134170"
variation 11908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645980422"
variation 11910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1173836103"
variation 11914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360773338"
variation 11918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:552211427"
variation 11920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:570414684"
variation 11922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645980706"
variation 11924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:190068140"
variation 11931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172290343"
variation 11932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757576530"
variation 11933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645981388"
variation 11937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:938353158"
variation 11943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1007008303"
variation 11948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1018285710"
variation 11949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149163525"
variation 11950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645981704"
variation 11952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:912995495"
variation 11953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310507008"
variation 11957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1356863618"
variation 11961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645981907"
variation 11966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1313235178"
variation 11971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645982028"
variation 11985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:898460552"
variation 11991..12000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttctt"
/replace="tttctttctt"
/db_xref="dbSNP:1246563466"
variation 11994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:193204277"
variation 12002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042793716"
variation 12004..12030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agaacaaccagtgtcaccaggtatgag"
/replace="agaacaaccagtgtcaccaggtatgagaacaaccagtgtcaccaggta
tgag"
/db_xref="dbSNP:1339311810"
variation 12008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477092800"
variation 12010..12023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="accag"
/replace="accagtgtcaccag"
/db_xref="dbSNP:1213116304"
variation 12012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427185544"
variation 12014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771887940"
variation 12019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1308271391"
variation 12020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571392090"
variation 12023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210499147"
variation 12024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:900361502"
variation 12026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731916"
variation 12028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645982854"
variation 12031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645982902"
variation 12034..12037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1645982951"
variation 12035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645983009"
variation 12037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1386145677"
variation 12043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1255478039"
variation 12050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645983185"
variation 12052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320837542"
variation 12058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1330109319"
variation 12070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433685241"
variation 12072
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1486733663"
variation 12073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368992746"
variation 12074..12084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atttatt"
/replace="atttatttatt"
/db_xref="dbSNP:1557633790"
variation 12078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645983564"
variation 12085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228316139"
variation 12086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267078324"
variation 12087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:867210431"
variation 12088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:535270883"
variation 12094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731956"
variation 12096..12097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:2148731957"
variation 12098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:556704991"
variation 12101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266666866"
variation 12102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:995516199"
variation 12103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:143723018"
variation 12112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027816144"
variation 12113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645984324"
variation 12114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:184939951"
variation 12120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564988943"
variation 12126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645984513"
variation 12127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1037409376"
variation 12128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:897137584"
variation 12130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645984671"
variation 12131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1478352732"
variation 12134..12135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ca"
/db_xref="dbSNP:1645984799"
variation 12136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1433687798"
variation 12137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645984944"
variation 12141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:958443914"
variation 12142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645985054"
variation 12143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991235686"
variation 12144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1409603894"
variation 12144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1473468758"
variation 12152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1159541645"
variation 12153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:996026993"
variation 12157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:548438182"
variation 12159
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645985441"
variation 12164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:947018571"
variation 12165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434722116"
variation 12166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571392261"
variation 12171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645985663"
variation 12172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1349919648"
variation 12174..12181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taa"
/replace="taagataa"
/db_xref="dbSNP:755974130"
variation 12177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977126034"
variation 12180..12189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aat"
/replace="aatacccaat"
/db_xref="dbSNP:1645985908"
variation 12180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645985847"
variation 12184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645985973"
variation 12188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001619664"
variation 12192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:550918434"
variation 12193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645986209"
variation 12195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986255"
variation 12202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1229399720"
variation 12205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1283911043"
variation 12209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11263839"
variation 12213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051688201"
variation 12216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:891328088"
variation 12219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986782"
variation 12222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780701723"
variation 12223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986930"
variation 12225..12227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1645987003"
variation 12226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146481099"
variation 12237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249536680"
variation 12238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1278385240"
variation 12239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645987953"
variation 12241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350343925"
variation 12244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645988075"
variation 12245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:968398401"
variation 12251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:559571643"
variation 12255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645988275"
variation 12257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:995485036"
variation 12261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1414006163"
variation 12262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645988661"
variation 12269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645988724"
variation 12270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1445175870"
variation 12272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1305566237"
variation 12278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1372959969"
variation 12279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217920228"
variation 12280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333997978"
variation 12282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645989073"
variation 12288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1025669719"
variation 12293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645989207"
variation 12297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645989264"
variation 12310..12314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tcttt"
/db_xref="dbSNP:1645989313"
variation 12312..12314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1242470958"
variation 12312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247378787"
variation 12318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1453640010"
variation 12319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989501"
variation 12323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571392461"
variation 12324..12329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1645989615"
variation 12325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989673"
variation 12331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:921698461"
variation 12339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1191519402"
variation 12342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:887014334"
variation 12343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645989900"
variation 12344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989950"
variation 12346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:533887056"
variation 12347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:530183670"
variation 12351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276852075"
variation 12356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344318585"
variation 12360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990366"
variation 12365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002828799"
variation 12366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645990508"
variation 12367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035927223"
variation 12369..12371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1396447344"
variation 12369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:958491341"
variation 12373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1440503374"
variation 12374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1454463169"
variation 12375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990826"
variation 12378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990904"
variation 12381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157441159"
variation 12386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991020"
variation 12391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1243379749"
variation 12394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645991123"
variation 12406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051559876"
variation 12410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1166236015"
variation 12411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1391478845"
variation 12413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991327"
variation 12422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769437079"
variation 12427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1382205794"
variation 12430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021299293"
variation 12434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320931704"
variation 12438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400641517"
variation 12439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645991632"
variation 12442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1390026558"
variation 12444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940563221"
variation 12446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:772679199"
variation 12448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991938"
variation 12459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645991998"
variation 12460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645992071"
variation 12464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301734060"
variation 12466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542071503"
variation 12468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:140969609"
variation 12474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645992325"
variation 12479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645992383"
variation 12482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645992429"
variation 12483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645992477"
variation 12484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:924330559"
variation 12485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1255367362"
variation 12487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342701448"
variation 12488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935573817"
variation 12490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148732198"
variation 12492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1279007528"
variation 12496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987031222"
variation 12497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263511842"
variation 12503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645992926"
variation 12506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:61588338"
variation 12509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645993120"
variation 12511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993181"
variation 12512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762650705"
variation 12513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:151209493"
variation 12515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:3185860"
variation 12516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645993405"
variation 12517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:617254"
variation 12521..12528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctattct"
/replace="tctattctattct"
/db_xref="dbSNP:1645993556"
variation 12524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:546851825"
variation 12528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1047496021"
variation 12530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993755"
variation 12537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:887152481"
variation 12540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993882"
variation 12542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528057622"
variation 12545
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254691093"
variation 12550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994114"
variation 12554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994175"
variation 12558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1322836145"
variation 12566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468625617"
variation 12567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:546700653"
variation 12569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994690"
variation 12571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994738"
variation 12578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1035797650"
variation 12579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148732262"
variation 12582..12585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1329329536"
variation 12585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1057016314"
variation 12586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774166730"
variation 12590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:894411906"
variation 12595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328197100"
variation 12599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:617673"
variation 12607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645995262"
variation 12609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767517357"
variation 12612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645995367"
variation 12616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645995429"
variation 12618..12619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1571392793"
variation 12618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269631761"
variation 12620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021438273"
variation 12622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470842580"
variation 12627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:968427356"
variation 12628..12629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645995834"
variation 12628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1158659180"
variation 12629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:538220647"
variation 12630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645995946"
variation 12638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148732301"
variation 12644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:998649331"
variation 12645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1208787348"
variation 12646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645996125"
variation 12651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732312"
variation 12663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1264651380"
variation 12663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645996176"
variation 12664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645996290"
variation 12667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645996337"
variation 12668..12672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ga"
/replace="gagga"
/db_xref="dbSNP:2148732324"
variation 12668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435467966"
variation 12670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031750925"
regulatory 12672..12677
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: ATTAAA"
variation 12675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1461411805"
variation 12684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645996576"
variation 12687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411815515"
variation 12691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1471831102"
variation 12692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161741391"
variation 12693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1010933207"
polyA_site 12695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="major polyA site"
variation 12695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:954369519"
variation 12696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:535494736"
variation 12698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645996920"
variation 12699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397201950"
variation 12707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997025"
variation 12712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291927465"
variation 12713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997119"
variation 12715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556743507"
variation 12718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:912794404"
variation 12723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:568710793"
variation 12724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328509541"
variation 12734..12735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645997459"
variation 12735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1349724926"
variation 12736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645997560"
variation 12737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997604"
variation 12742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997657"
variation 12743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:964311587"
variation 12746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645997748"
variation 12751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:975565048"
variation 12756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645997839"
variation 12757..12761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1289970722"
variation 12757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:920123616"
variation 12758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:931383205"
variation 12759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645998053"
variation 12761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317214475"
variation 12762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645998148"
variation 12763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:921685638"
variation 12766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263224418"
variation 12767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645998386"
variation 12769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645998430"
variation 12773..12783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagaagaa"
/replace="aagaagaagaa"
/db_xref="dbSNP:1489191079"
variation 12776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1047104846"
variation 12783..12789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aag"
/replace="aagtaag"
/db_xref="dbSNP:953077202"
variation 12783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1482325926"
variation 12786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:987319587"
variation 12787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645998748"
variation 12802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:908631026"
variation 12811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1423500069"
variation 12816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645998885"
variation 12820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645998944"
variation 12822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1334020336"
variation 12823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732424"
variation 12828..12833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttgttt"
/db_xref="dbSNP:1425388438"
variation 12828..12832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttgtt"
/db_xref="dbSNP:551871231"
variation 12831..12833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1571393013"
variation 12832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645999245"
variation 12835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1307434820"
variation 12839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:754003469"
variation 12842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:911758811"
variation 12843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763435450"
variation 12847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1373764064"
variation 12852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:894380672"
variation 12854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:11803162"
variation 12855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1323075098"
variation 12859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393070"
variation 12861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645999839"
variation 12865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1195017326"
variation 12873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557614640"
variation 12877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1340744989"
variation 12879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207879034"
variation 12880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233865788"
variation 12883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646000122"
variation 12885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646000167"
variation 12888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646000219"
variation 12891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1483140763"
variation 12892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:188246113"
variation 12896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180440137"
variation 12901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646000397"
variation 12902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1258548504"
variation 12905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646000491"
variation 12915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646000550"
variation 12922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1445453595"
variation 12925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1388370039"
variation 12933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1427799237"
variation 12935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646001427"
variation 12936..12937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1646001486"
variation 12938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172476848"
variation 12945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646001597"
variation 12946..12950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1465366528"
variation 12946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1300800227"
variation 12947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646001729"
variation 12949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1384613036"
variation 12953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:765512570"
variation 12957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296280568"
variation 12958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646001941"
variation 12969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:999103079"
variation 12972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1031390116"
variation 12974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1274361357"
variation 12977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1312064304"
variation 12985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1048361259"
variation 12991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:954633333"
variation 13002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1008543100"
variation 13007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1646002395"
variation 13007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646002331"
variation 13010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258131628"
variation 13016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148732519"
variation 13019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646002496"
variation 13020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646002562"
variation 13021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646002643"
variation 13022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1461969099"
variation 13026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646002723"
variation 13036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646002777"
variation 13037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750676879"
variation 13041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:372215826"
variation 13046..13051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agatag"
/replace="agatagatag"
/db_xref="dbSNP:747128678"
variation 13046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1246372871"
variation 13047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646003040"
variation 13049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:541089374"
variation 13051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420464265"
variation 13057..13059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1458669625"
variation 13061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420152307"
variation 13063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:975699442"
variation 13066..13069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1646003844"
variation 13070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:920175823"
variation 13073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1407985565"
variation 13077..13082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:879476871"
variation 13078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:553296373"
variation 13080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:983370268"
variation 13084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1166121037"
variation 13088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000280959"
variation 13090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646004353"
variation 13092..13093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1028638611"
variation 13093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571393323"
variation 13094..13101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/replace="aaaaaaaaa"
/db_xref="dbSNP:537923747"
variation 13094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:908602603"
variation 13095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:181064431"
variation 13098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:542295369"
variation 13101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:563919064"
variation 13102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:112898338"
variation 13103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1480657929"
variation 13104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646005279"
variation 13105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249438005"
variation 13118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1341003490"
variation 13120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646005638"
variation 13123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948637090"
variation 13124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409385468"
variation 13129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042915926"
variation 13130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1318454112"
variation 13134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1348773393"
variation 13138..13145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atga"
/replace="atgaatga"
/replace="atgaatgaatga"
/db_xref="dbSNP:927327408"
variation 13142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346625871"
variation 13146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:937333611"
variation 13149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546552052"
variation 13155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646006216"
variation 13158..13166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aata"
/replace="aataaaata"
/db_xref="dbSNP:1646006249"
regulatory 13158..13163
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: AATAAA"
variation 13161..13164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1057183876"
variation 13161
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646006294"
variation 13162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1353187187"
variation 13165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:895865063"
variation 13167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278971952"
variation 13175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:113322531"
polyA_site 13180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
variation 13181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:751968895"
variation 13186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1041857755"
variation 13187..13189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1490476437"
variation 13188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260154197"
variation 13189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646006975"
variation 13190..13197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tatt"
/replace="tatttatt"
/db_xref="dbSNP:1181268134"
variation 13190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409449668"
variation 13192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556209808"
variation 13193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646007200"
variation 13196..13197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1158810267"
variation 13199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1412573968"
variation 13201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646007375"
variation 13207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890196881"
variation 13211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164876514"
variation 13214
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366804179"
variation 13219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000473891"
variation 13220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646007686"
variation 13221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646007746"
variation 13223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:528752687"
variation 13228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371743303"
variation 13229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732668"
variation 13233..13238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1646007997"
variation 13233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1337878891"
variation 13234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008067"
variation 13238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1017276949"
variation 13241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646008138"
variation 13245..13251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agta"
/replace="agtagta"
/db_xref="dbSNP:1571393515"
variation 13246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1646008232"
variation 13248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008319"
variation 13250..13260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taaataa"
/replace="taaataaataa"
/db_xref="dbSNP:1463701048"
variation 13253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283853555"
variation 13261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1354426697"
variation 13263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008521"
variation 13264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008564"
variation 13268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008605"
variation 13274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008643"
variation 13275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1029234276"
variation 13276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008780"
variation 13286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360124812"
variation 13288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204324335"
variation 13293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:755507279"
variation 13296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:994515114"
variation 13296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1248268375"
variation 13302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1646009159"
variation 13305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646009214"
variation 13307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439377406"
variation 13312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646009303"
variation 13318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027212716"
variation 13319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:150294351"
variation 13320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646009423"
variation 13322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732720"
variation 13324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1375077345"
variation 13328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646009514"
variation 13336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1471600869"
variation 13340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393572"
variation 13341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1184975862"
variation 13342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:137937874"
variation 13344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646009749"
variation 13346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1018716062"
variation 13350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747667827"
variation 13351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557634949"
variation 13352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:972327090"
variation 13353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:755634987"
variation 13354..13356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1333857852"
variation 13356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:992913212"
variation 13357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027513323"
variation 13359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:866611493"
variation 13360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:915999164"
variation 13361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571393625"
variation 13362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1315881943"
variation 13363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948694188"
variation 13364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951959518"
variation 13365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646010429"
variation 13366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:369177016"
variation 13367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1249546128"
variation 13368..13375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/replace="aaaaaaaaa"
/db_xref="dbSNP:926539078"
variation 13372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646010659"
variation 13376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646010719"
variation 13377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978750367"
variation 13378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1277644378"
variation 13380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646010976"
variation 13381..13389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggggtaggg"
/db_xref="dbSNP:1459736713"
variation 13381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:757440604"
variation 13382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646011106"
variation 13383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646011168"
variation 13386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:937345012"
variation 13391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011287"
variation 13394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011345"
variation 13395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732793"
variation 13396..13414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggagggtggagaagagag"
/replace="gggagggtggagaagagagggagggtggagaagagag"
/db_xref="dbSNP:1646011402"
variation 13400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646011442"
variation 13402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:992754289"
variation 13403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1557635040"
variation 13407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777335358"
variation 13408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011644"
variation 13409..13418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agagagag"
/replace="agagagagag"
/replace="agagagagagag"
/db_xref="dbSNP:917332610"
variation 13409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400487753"
variation 13410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052949107"
variation 13412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1337672685"
variation 13413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042173951"
variation 13415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433002965"
variation 13416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890323189"
variation 13419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:944523722"
variation 13422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646012268"
variation 13423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:926170271"
variation 13426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646012396"
variation 13428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328194233"
variation 13432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228031040"
variation 13433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274083950"
variation 13434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1038766385"
variation 13435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:936153832"
variation 13438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646012670"
variation 13439..13442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1646012732"
variation 13443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646012802"
variation 13444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646012848"
variation 13448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646012914"
variation 13449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:900268718"
variation 13451..13455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gctcc"
/db_xref="dbSNP:1646013091"
variation 13451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263381056"
variation 13455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646013169"
variation 13457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:994483877"
variation 13458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027759385"
variation 13460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1260081808"
variation 13463..13468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:1430597782"
variation 13469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189626933"
variation 13472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:748935515"
variation 13473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646013928"
variation 13477..13478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tg"
/db_xref="dbSNP:1646013985"
variation 13478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646014059"
variation 13480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646014128"
variation 13481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571393759"
variation 13482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:888693143"
variation 13483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393772"
variation 13484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:529029363"
variation 13487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550254208"
variation 13489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448127823"
variation 13493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1198804497"
variation 13499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1452846937"
variation 13502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646014790"
variation 13503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:568745685"
variation 13504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:539225869"
variation 13505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481624921"
variation 13506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646014975"
variation 13507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646015038"
variation 13511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646015106"
variation 13513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1177526516"
variation 13518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557502575"
variation 13519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1008583388"
variation 13522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770599707"
variation 13523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566671117"
variation 13526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571393823"
variation 13529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1290747057"
variation 13530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385739329"
variation 13532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:992965566"
variation 13533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149480174"
variation 13536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1359870567"
variation 13538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571393854"
variation 13539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452955599"
variation 13540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372205273"
variation 13541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646016011"
variation 13542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1283671820"
variation 13552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1387050257"
variation 13553..13555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1328134606"
variation 13554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1236404859"
variation 13556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435466336"
variation 13558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:978718021"
variation 13559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:993290863"
variation 13561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016404"
variation 13562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:925979776"
variation 13563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951950535"
variation 13566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732980"
variation 13569..13571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1646016530"
variation 13572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732983"
variation 13576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955978316"
variation 13578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016728"
variation 13579..13583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtg"
/replace="gtgtg"
/db_xref="dbSNP:1490979203"
variation 13580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1200680347"
variation 13583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016843"
variation 13585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1251501560"
variation 13586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:989092655"
variation 13589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:145835702"
variation 13590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:138746703"
regulatory 13594..13599
/regulatory_class="polyA_signal_sequence"
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="hexamer: ATTAAA"
variation 13594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:960582832"
variation 13597..13599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaaa"
/db_xref="dbSNP:530985639"
variation 13600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646017641"
variation 13603..13606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:150609292"
variation 13608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148733025"
variation 13610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1557635273"
variation 13610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:967767747"
variation 13611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646017835"
variation 13613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1303579430"
polyA_site 13617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
ORIGIN
ggagccaaatgtggacctgtgaggacgccacgtgagagggaagcccgtgaggcaagcgcctcaggagtgcgtgaggcccacgcagaactcggggagccttttatcctgaggacacaggggaagaattggaggactatattcagctgcgggcgcttacctgccccccctgcagcaggtgttccaggcacctcgccggcctggcattggcactgtggggaaaccaatcaagctcctggccaattactttgaggtggacatccctaagatcgacgtgtaccactacgaggtggacatcaagccggataagtgtccccgtagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatctttggtgatcgcaagcctgtgtatgatggaaagaagaacatttacactgtcacagcactgcccattggcaacgaacgggtcgactttgaggtgacaatccctggggaagggaaggatcgaatctttaaggtctccatcaagtggctagccattgtgagctggcgaatgctgcatgaggccctggtcagcggccagatccctgttcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcatccatgaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagccactgccttttataaggcacagccagtgattgagttcatgtgtgaggtgctggacatcaggaacatagatgagcagcccaagcccctcacggactctcagcgcgttcgcttcaccaaggagatcaagggcctgaaggtggaagtcacccactgtggacagatgaagaggaagtaccgcgtgtgtaatgttacccgtcgccctgctagccatcagacattccccttacagctggagagtggacagactgtggagtgcacagtggcacagtatttcaagcagaaatataaccttcagctcaagtatccccatctgccctgcctacaagttggccaggaacaaaagcatacctaccttcccctagaggtctgtaacattgtggctgggcagcgctgtattaaaaagctgaccgacaaccagacctcgaccatgataaaggccacagctagatccgctccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttgggatcaaagtgaaggatgacatgacggaggtgacagggcgagtgctgccggcgcccatcttgcagtacggcggccggaaccgggccattgccacacccaatcagggtgtctgggacatgcgggggaaacagttctacaatgggattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaaacagtgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcggggatgcctatccagggtcaaccttgtttctgcaaatatgcacagggggcagacagcgtggagcctatgttccggcatctcaagaacacctactcagggctgcagctcattattgtcatcctgccagggaagacgccggtgtatgctgaggtgaaacgtgtcggagatacactcttgggaatggctacgcagtgtgtgcaggtgaagaacgtggtcaagacctcacctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgccgtttttcaacagccagtgatattcctgggagcagatgttacacaccccccagcaggggatgggaaaaaaccttctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgtgctactgtgcgggtacagcgaccacggcaagagatcattgaagacttgtcctacatggtgcgtgagctcctcatccaattctacaagtccacccgtttcaagcctacccgcatcatcttctaccgagatggggtgcctgaaggccagctaccccagatactccactatgagctactggccattcgtgatgcctgcatcaaactggaaaaggactaccagcctgggatcacttatattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaatgagcgaattgggaagagtggtaacatcccagctgggaccacagtggacaccaacatcacccacccatttgagtttgacttctatctgtgcagccacgcaggcatccagggcaccagccgaccatcccattactatgttctttgggatgacaaccgtttcacagcagatgagctccagatcctgacgtaccagctgtgccacacttacgtacgatgcacacgctctgtctctatcccagcacctgcctactatgcccgcctggtggctttccgggcacgataccacctggtggacaaggagcatgacagtggagaggggagccacatatcggggcagagcaatgggcgggacccccaggccctggccaaagccgtgcaggttcaccaggatactctgcgcaccatgtacttcgcttgaaggcagaacgctgttacctcactggatagaagaaagctttccaagccccaggagctgtgccacccaaatccagaggaagcaaggaggagggaggtggggtagggaggagtgtaggatgccttgtttccttctatagaggtggtgtaagagtggggaacagggccagcaagacagaccaccagccagaaatctctgatatcaacctcatgtcccccacccctcaccccatcttgtcacatctggccctgaccccactggaccaaaaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtaaggtcaactctgtagccctgcagacaaaagctggttaggtttgggtttgatactttagatgggaaagtgaggggcttgagaaagtgggtgggaggagggaaggattttttaggagccttaatcagaaaaggactagatttgtttaagaagaaaaatgaaaccagacccagatcaatattttaggatactagatgttttaatgggttcagaatccagtttgtaggaagattttttaatggttttggttgctcctcccccagctgccaccccccaccttacccttattcctctctgtccacattttctgccccaccttacttctcctccctgacagacatccagcccctagtaatacttaaggcactatggcacttagctttgaagtgacacgaccctgtcttccttccgcccgctggtgggtaaccagtgccttccctgtaacggtaatgctgcagaactgcaaccttttgtacctttctttggggaatggggtgggggtgggagaggaggtagatggggaagaaataccccagacccaacaaacctccagccagaaagccagctattttgcatttgaaggaattgacttcctcattcattgagctttttaaaagatcacaacctcaagatggttaaaatccattgacatttgcactttcaaacatgacaagtctcggagctgctgagatgacaggcccctggcctttccacttatgcctccttttctccttattcctcctacctcccgccccgcccaggtctggagttactttcatagcatttttcactcttggcttcttttctcccttgatggtcaagtctcttatgtttcaatatttcttaactggggtgtcttataacaaaaaactcttaggtctaaaatgagaaaaaagagagaaaacaaaatgttatttttataccataacttgagtgtattgccaaaatttggaaatccttcccatgcctgatgagtttatatcccagaaacattgagccatcagaatgaactgtgtacctgatttgttctctgacctggctaggtagggagggggtggttatcgccccaagatggggtccaggctccatccttcctctgtgcagataatacctttttcttgctatagcctccctcctctgcactgtcctgcactctttcttgcaagtgcatctttttccttcccctggactgtcctctgaccctttggctcatcctagattgcagtgtgtcctgtggacaggctggggaattttgctgctccctattgcttctgtttacaaaaatgaatttttcctggtttcccactagggcatgtgggtgggtggcatggacttttttttttttttttttttgtcttgagacatggggtttggctgtcttgcaggactggagaaggtggtggttctagcttggtctctgttggccttgaagcaagcatcccccctgccctttttccttgactgttcatttttttcctgccccactgcttgggatggggagttgcaacttcagtgtggaatttcctctttgaggagcctgggcttggatctatcctgatctggtgatgaagccatgattactttagacctagcccaggcttggaggccagctggaggaagaagggtctaaatcctggcctgtagagttagaactaccatttcctccccttagctgcccttgtatgacccggatttgctatgcaaaacaatctatcccaggttctgttctggttggctacattgttcagcaactcacaaaacgtagcacaaacattcattatggagaaagcatcaggactgttgagtaactcctcctttacttttttcctgctggctacagcatggggtgccctataggcacaagcccagctgaagaacagaatggagggctctgggaggaggcagctcactggagagcctacattccttacacaagtgcctaaagagagtgatgctaacactccatctgccctgtccattgccttcatatacagtctacttcgtgttctgtcaccctttggggaggggagttctcctgggacagtgggctctgcatgttctccacttggatacattttggggctaggatcagggcactattcctggagggtccagtcattcaccagcatttgcaaatgtccatagggagcaggtggcagcctctactcccagcaacaagtttgtgttctctccttttctctctttgcctcactctctccagttggttttcagctggggcttgaaatgcatttttagccctttgacgtggcttatgccattcaagaaataaaaagcaagagaatcagctttgggcaatgacaagaaatgagttcttactctgatttttttgtaaaaagataatttttgagacttgaaaaataccccgaccttgagattattcctgtttgaaaggtggtgcatgcagatggagaagtggtgttggcagcaagctttggctcatgtggatttggtttaagtggtgcttcttacccaagcttcaaggaagtgcttgggggacccccagcctcatcctcttagttgggtctcttgttccctttgtaccactgttttgccttccttttcctcttctctctttgcctggcttcctttcccttttcttctattcactctgcttgcttgctggccggcctgcctgcctgcctgcctgcctgcctgcctgtctgcctatgtgatgatgaaatctctgcatggctgcaatgatcccactgttagctggcagggtcaggcttagctccttgactgcagaagaccaagaacctgttccccaagcccagagatgtccacctgggctggactgccctcaagcttatactagagaagagcaactgacctgcccaacttgtgtgaagtcaggagggtttctggcattttccacacctgtccactccttggagctggtttctctcattgctttttctaaatctggttctttttctctttacctggggcctggcttttctgagattgtcttagggttgagctatttgggtatcctgggtttgagtgttaggggatggacataaaggaaaaagagtgatgagaagagaatggagagaatttgaataaaaggtgggaaaggagagcactgttctttgattgtttatccagtccaacctgatccattagggatcgaggtgctacactggcctccagggataagcctggggctactgttgctgggaacttaggcttaacataaagccgaagaaggtacctagaaatttgaaacttccctaaaaagctcctaatgcccacctgctagatagcttctctgtggcctcctatttagctaagcagcagtgtttttggatactttttttttctgtttgtgaataaggccagcactcaagatgggcagccaagggtgcactgactattagctggcccataggatatctgtaaggctggtgggacagttttggacctggaatcatgtgtaactaacaaggttggacgtttcttccccatcagggtagaaaaatcatctcaaactagccaaaaggcagttttggaaactacattgggggacgttatttttatttatatatggggcctaggccaatccaggatggtagctggaataccttccttcttaaaatctgatcatggcagggatatgcagggcactttttactatttggccttctaagcagattgggaaggaggtattttctggttttcgctttcctccgacttaataggacttgccttctccctgggcagggagagaggctgggttggtgctctcccttactctactcatactgacttagagcctctggctgctgtttgggcatccaagaaagggaggggaaggaatgagctaaaaacaaaacagaatgaggtgggaaagggagattttcttctttacagaggaaaataggaaaccctccaagaattgtgcaagtaaagacatttgttgaatgcactgagtcccttggtgtagtagcaataaggaaaaatgaaattactttcctgtgcacacagtccagcctaattggtatgtgatgttgcacttagcagccatgtggtgggcatgtgtgactactctggttttcactttagtttctaaactttttatccctctcaagtccagcatggatggggaaatgtctctggatccccacagctgtgtacttgtttgcatttgtttccctttgagatttgtgtttgtgtcctgctttgagctgtaccttgtccagtccattgtgaaattatcccagcagctgtaatgtacagttccttctgaagcaagcaacatcagcagcagcagcagcagcagcacaattctgtgttttataaagacaacagtggcttctatttctaaagtgcggtctttctctttttttttcctaccagcaaaacaaacttttgggactgattacatctctaatagattttaggtgagaataatactgtagattgttatgcaggaatacttcacagagccttcatttattcttcattcaacaaacatgcaaagcactgtgccagcagtattgtggggaggggaggcacaattcaaaatgaggaaaatagtgtccgtctcattaagggaattaagtttggtgggggatatgattagccaaatagtcccctggcataggaggaagataatgagggagtggaataaggctacaacaacgaatatagggaggaagggacagatttgagagacgaggtagaattaataggactcgatggctggtgggaggagaagacaggagtagaggttagctcccaggtttctccttgaccataggagtgtgttgggacattctgccagtcaagatgggggtgacggggagactgtagaaggaaggtggggagtttttgaagaaacagaatgttgtatagactgagttttgaggtgtttgtggggcagtaagggtaaggtgtccagtaaacacaggttggtgctcaggtaagactgtaaaactgcatttatagatacaggagtcttatagatggtagttaaagccataggcatgaatgagatagcttagaaaaagagaagagaaactagtatacagccccctaagaaactcaatttaaaggttcgggggaggaagcagatcttaaggtgacagatcactggtagacagtttgtgggttttttgtttctttgtttagccagtttggtgaggtaggagaagaaatcagagtagaagaaggttcatgaagggagtgattaacaacatgaactgctgcagagagggagttctttttttttctgtgtgttttacctttctactccccatcttttggggatcttgtaactctatgacttacttacgttattctccagtatttcttgaaaatgagcattggaaaaaccaattctaaaatggctaaaactaggactttcaagttcaccacaactaccaccaattaggagataattgtaaaagaataaacaaaacctaattttgttcctagccaatattataaaccatgttccagcatactagataatagtagcatactatatttatttccataatttgtcttctttagagcctatgaactcctaggagcagaagctatattctcttcatttttgtcatctcagggtcatggcatataccaacagatcagtatgtgcaaatataattgaaataggctagtagtctgtggtttatgagtatgggctgggtgggcagtggatcaagaagtgataggagtacacaggatgaactcagaattcctgaatcttcaggtaagcagatacttaactacattatcattgtcttttcccactcaccccaagttggaggttctatggttttgtactttaagctggtggtataattgtcaagcatgtaaattctggcattcttcctggtactgctagagcattgttatttctatgcatgggggtaagaaggctcagagaaggatcctggcggataccccagtgagaaatcgtcagtggcagccagtgtgtacatacgtggacctagcattcctctggaggccaagtgttgtaaattggcctgtggctatcatctggcagactcccttgggaaagagccagccagccccatgcttcttttcagcagcaagggttagggaggttggttgaacttgaagagcagattggacatggagcagattttgaccagttgaaataagacataaatttatgactccgagtgaggcagaaataaagaacttagcagggggaataggaggaggatgattatggcaaattttgctataaactttagttttagaaaagattgatattgaaaagccttcaggatttgcctgtggttgctactcaagttaaaaagactgggagcctgcattgtttggtcctggagctcaaggttttcagtgaaggcttgtcctggcacctctgggcattccttttcattactggttgagcatccttccttctgctctgtcaattggcaaaatatgctggagcacattctggactagcagttgccttggggtagtcaggctgggtatttgtttggtatctcttggtgtagcagaccccagaatctcatggcaattaggatttggtggctaaacgaaagagttagtgcaaggaaaagcctagttggaatttctgagtctgggccatccttaagctgctgtctactgcctgaatgggaagtaatgtcgaattggaaaattagctcaccatttttgttctagctttgcagacatttattcctctgatgataggctgagaaatgcctaggccggcttagaaggcacacagcatgacagaagtactccttcaaagcagctgtgtcaagaaggaagagctggaaaagtggatttgctggggaattagatgcatttagttttccacttacgcacaactgccttctccagtatatcataccaaggttttttaggcctttgtggcttaccctgcaggaacatactgtgtcctgttgttctggactgtagcatcttcaccaccatcctcttggcaatggttttttgtttggggtttttttttttttttttttggacaaagtataataatattgagggacctttctagggagcctttggtcctttgtccccattttccaaagggagggaactttcctcttaaaagagacagtgggaacttttagccaggtttttggaaaaggcctgtgggctattaatgagagtgagctgcaaaaggaggaagggtttgtttgggtactttgaagtacttagctaggtgttttctacagtatcttatataattgcatcttacagcatctttacatgcgaaatagtttatcagttatcttcaattgcatattacaaaattctgattaaatttttcttaaataagaaaactatcatttcatatgacaagaaatcctaatttaatgttactccaaggttggttaattcagtggctcagtgataacaccaaagactcagtttcttgaaatttttttgctctgccatcctccatgtttatcctcacgccagttcgcctcatggtcccaatatggctactgtaattctgggaaggaaatgctgacagaaccgtgtctggcaaaagagagacagatttttctgtgtccttctaaagcaaggaagtcttcccctggaagctccaacagatacggcctcatggctttgctagaaatgggtcatctcactcctgtcattggcaaagcaagtaagatcatccatcaggagtggcttagattaatgaattatcctttgagtcgtgtagactagaaagttcagtcatgtctactagcaagaaaggagataagggctgttggataagcagcatctggtctcaaaggtacttcaacttttacagatgagaaacatgaatcagagtgactttcccaggctcacagcaagtaagagagggccttcagtgttagctgtgtctgtccctaaagcccatgttttatattgtatcttgctagagtataaagtaacttactttctaccttgtagaaactgatggtctaggagaagagatttgaactcaggtgcccagttgactctaatcttggcccatgtgagaggattgtactcagttgctctcctcatccagtgatgtttcttgtctaacacaagaagcctaggagtagaaagtcctaagcagagtagaataatagcggcagcagggagggaagtgtgaactgtgtgtccctgagcctgacttactgggcagggacatgacacttaaagcggcagctggccactctgtctttcctgcatgcactgagtatttggtagctcattagtgaccagtgatattgatcatcttttcatgtgctcacttactatccccatatctttgttgtttgcatcttttacccattgtatttgttgtttttgagacagtgtctcactctgtcacccaggctggagtgcagtctcatgatcgcggctcactgcagtttctgcctcctgggctcaagcaatcctcccacctcagcctcctgagtagctgggcttacaggcgcacaccaccatgcccagctaattaaaaaaaaaattttttttgtagcagttcggtctcattagtattgcccaggctggcctctcttagcttcaagctatcctcccgcctcggcctcccaaagtgctggaattacaggcataagccacaagccactgggcccagcctcttttacctgtttcaaaattgagttttattgagttgtaagagttctttattcattttaaacacaagtcctttgttggatatatcttttacatctatttttcccagtctgtggcttgccttttcattttgaagagcaaaagtttaaaattttgtgaatttattaaagctccgtttgttgcttttttctgttctagtttatacttttgtatcatattttaggaaattttgcactgggtatttgatggctcctgaggaggttcaactttcagagcgcactgatttctctgcacctgagattttgtactatttctgtatttctttcttctcagaacaaccagtgtcaccaggtatgagggcagagttttagcttgtttgctgagccccattcttgaagctcatttatttattcacctatctgtccatcaatccaacaaatatactgaatgctgctatgtgccaggtactggcactgttctaggtactggggcaatgacagttaagataatacccaatgaccctgctctgtacccttaagagcagactcagttgggaatgagttatccaaatatagggtgtacatgtagtcaggagagagcctcatacagctttgcctttggcagaatccttcaaacctctttgtcttcctacttcttgatattacaaatcatgagcctttcacatgcattgactctaaagaggtgggttcctggatagcagaagtagataggaaggcatcattgacatttactgagatggattgaatcagagggtgtaaattctgctccatcaatgttgaaaaagactagcccaccccaaaggtttatcactgtcaccatgtctaatgtctattctggaagaagctgaagaagtctgcctttgtttagggaaccggttccagaatcagaggggttgaggatataaaagacccttgcacaagagttggtatttaccctgtcagatgctgctaccaagatttggattgtgtacagtcgaggattaaaaatgacttttaagatgcagtgtttcatctggtgacatttaatttgatattttaaaattggggagggtattttcagccatgggggtagggatgtgaaagaagaagaaagtaagaattggagtcagatgtggttttgagtcccatacatttattgtttaatattatatggtaagtactttaaaatggtaaatagtaaatacttgtgttattcactaacatttggggaggattttctctgtgctttatgtatattacctaaccttacaaactgtgtaaggtacatgctgttctctcaatttttcagataagaaaattgaagcccagagagatcaagtgactgatccaaagtcccacagtgaggggaactgaagataggatattctttctccttttcctctttaaaaaattattttgattaaaaaaaaccgtattactgaagcatagggacatggggagaaattatgaatgattcctcagcctgaataaaatagtatgtttcattaaggcaacaaatatttattaaggacctaatatttgcctgacattcaagtgaggtggggggcacacaagtagtaaataaataacagactgggcaaagggctaccaaggcaatactgtagtagactaacaggtgccccaccatagatgggtggtccggaaaaggcgtctcagatgtctttcgttgagacgcaaaaaaaagctgtggggtagggcgtaaggggagggtggagaagagagagagggttcctggccaagggaaccaaaagcagagaagctccaagtcagaaaaaagcagcggttggcccgttgggagaattggaagccaaccagtatagctgtagcacaggcggggcccatttacgccgtgcgttttcaccctggaaaggagtttgggttttcaagtgtgacgaggcgctattaaagagttttaaacatggaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]