GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-29 03:53:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001130167            2031 bp    mRNA    linear   PRI 27-DEC-2022
DEFINITION  Homo sapiens pregnancy specific beta-1-glycoprotein 8 (PSG8),
            transcript variant 2, mRNA.
ACCESSION   NM_001130167
VERSION     NM_001130167.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2031)
  AUTHORS   Olsen A, Teglund S, Nelson D, Gordon L, Copeland A, Georgescu A,
            Carrano A and Hammarstrom S.
  TITLE     Gene organization of the pregnancy-specific glycoprotein region on
            human chromosome 19: assembly and analysis of a 700-kb cosmid
            contig spanning the region
  JOURNAL   Genomics 23 (3), 659-668 (1994)
   PUBMED   7851895
REFERENCE   2  (bases 1 to 2031)
  AUTHORS   Khan WN, Teglund S, Bremer K and Hammarstrom S.
  TITLE     The pregnancy-specific glycoprotein family of the immunoglobulin
            superfamily: identification of new members and estimation of family
            size
  JOURNAL   Genomics 12 (4), 780-787 (1992)
   PUBMED   1572651
REFERENCE   3  (bases 1 to 2031)
  AUTHORS   Coto E, Martinez-Naves E, Dominguez O, DiScipio RG, Urra JM and
            Lopez-Larrea C.
  TITLE     DNA polymorphisms and linkage relationship of the human complement
            component C6, C7, and C9 genes
  JOURNAL   Immunogenetics 33 (3), 184-187 (1991)
   PUBMED   1672663
REFERENCE   4  (bases 1 to 2031)
  AUTHORS   Borjigin J, Tease LA, Barnes W and Chan WY.
  TITLE     Expression of the pregnancy-specific beta 1-glycoprotein genes in
            human testis
  JOURNAL   Biochem Biophys Res Commun 166 (2), 622-629 (1990)
   PUBMED   2302228
REFERENCE   5  (bases 1 to 2031)
  AUTHORS   Oikawa S, Inuzuka C, Kosaki G and Nakazato H.
  TITLE     Exon-intron organization of a gene for pregnancy-specific beta
            1-glycoprotein, a subfamily member of CEA family: implications for
            its characteristic repetitive domains and C-terminal sequences
  JOURNAL   Biochem Biophys Res Commun 156 (1), 68-77 (1988)
   PUBMED   3263130
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC137500.1, BC142628.1, BX114490.1 and AC004654.1.
            
            On May 31, 2019 this sequence version replaced NM_001130167.1.
            
            Summary: The human pregnancy-specific glycoproteins (PSGs) are a
            group of molecules that are mainly produced by the placental
            syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of
            the carcinoembryonic antigen (CEA) family, which belongs to the
            immunoglobulin superfamily. For additional general information
            about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM,
            Oct 2009].
            
            Transcript Variant: This variant (2) differs in the 3' UTR and
            coding sequence compared to variant 1. The resulting isoform (b)
            has a shorter and distinct C-terminus compared to isoform a.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC142628.1, CR749812.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1968968,
                                           SAMEA2142853 [ECO:0006172]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-11                BC137500.1         2-12
            12-1491             BC142628.1         1-1480
            1492-1850           BX114490.1         350-708
            1851-2030           BC142628.1         1840-2019
            2031-2031           AC004654.1         23059-23059         c
FEATURES             Location/Qualifiers
     source          1..2031
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.2"
     gene            1..2031
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="pregnancy specific beta-1-glycoprotein 8"
                     /db_xref="GeneID:440533"
                     /db_xref="HGNC:HGNC:9525"
                     /db_xref="MIM:176397"
     exon            1..161
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /inference="alignment:Splign:2.1.0"
     variation       1..5
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ag"
                     /replace="agaag"
                     /db_xref="dbSNP:942835211"
     variation       3
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1331975865"
     variation       4
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354406224"
     variation       6
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289672863"
     variation       9
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:912734729"
     variation       10
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534233812"
     variation       17
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347785264"
     variation       19
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1392922537"
     variation       21
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:571949778"
     variation       23
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280134106"
     variation       24
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483488689"
     variation       25
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970201057"
     variation       27
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970201016"
     variation       30
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2122295002"
     variation       31
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207649404"
     variation       32
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249698363"
     variation       35
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987012529"
     variation       38
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:551635334"
     variation       43
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970200733"
     variation       44
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378084364"
     variation       46
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253904702"
     variation       49
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170561515"
     variation       51
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762517047"
     variation       52
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754197910"
     variation       53
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1970200423"
     variation       54
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970200378"
     variation       55
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429980910"
     variation       57
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309402511"
     variation       58
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538084246"
     variation       59
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569073584"
     variation       61
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776107045"
     variation       63
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369010869"
     variation       63
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1292837925"
     variation       64
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250320053"
     variation       65
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759610460"
     variation       67
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774326303"
     variation       68
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1600425982"
     variation       69
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771114706"
     variation       70
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439628924"
     variation       71
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369312871"
     variation       72
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749522143"
     variation       74
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375994401"
     variation       75
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343390676"
     variation       76
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396373254"
     variation       78..84
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="acaca"
                     /replace="acacaca"
                     /db_xref="dbSNP:772403302"
     variation       79
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568381976"
     variation       81
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166627573"
     variation       82..89
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="acag"
                     /replace="acagacag"
                     /db_xref="dbSNP:748571020"
     variation       82
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200337862"
     variation       83
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970199057"
     variation       85
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747988704"
     variation       86
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781138692"
     variation       87
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554451127"
     variation       89
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746461659"
     variation       90
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568381942"
     variation       94
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536412761"
     variation       96
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452807456"
     variation       97
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963052145"
     CDS             98..1357
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="isoform b precursor is encoded by transcript
                     variant 2; C3 alternate; pregnancy-specific beta-1
                     glycoprotein; C1 alternate; C2 alternate; PSBG-8;
                     PS-beta-G-8; pregnancy-specific glycoprotein 8"
                     /codon_start=1
                     /product="pregnancy-specific beta-1-glycoprotein 8 isoform
                     b precursor"
                     /protein_id="NP_001123639.1"
                     /db_xref="CCDS:CCDS46091.1"
                     /db_xref="GeneID:440533"
                     /db_xref="HGNC:HGNC:9525"
                     /db_xref="MIM:176397"
                     /translation="
MGLLSAPPCTQRITWKGLLLTASLLNFWNPPTTAQVTIEAQPTKVSEGKDVLLLVHNLPQNLTGYIWYKGQIRDLYHYITSYVVDGQIIIYGPAYSGRETIYSNASLLIQNVTQEDAGSYTLHIIMGGDENRGVTGHFTFTLYLETPKPSISSSKLNPREAMEAVSLTCDPETPDASYLWWMNGQSLPMSHRLQLSETNRTLFLLGVTKYTAGPYECEIRNPVSASRSDPFTLNLLPKLPKPYITINNLKPRENKDVLNFTCEPKSENYTYIWWLNGQSLPVSPRVKRPIENRILILPSVTRNETGPYQCEIRDQYGGIRSYPVTLNVLYGPDLPRIYPSFTYYRSGEVLYLSCSADSNPPAQYSWTINGKFQLSGQKLFIPQITTKHSGLYACSVRNSATGKESSKSMTVKVSDWTLP"
     sig_peptide     98..199
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    203..472
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="First immunoglobulin (Ig)-like domain of
                     carcinoembryonic antigen (CEA) related cell adhesion
                     molecule (CEACAM); Region: IgV_CEACAM_D1; cd05774"
                     /db_xref="CDD:409430"
     misc_feature    206..262
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="FR1 [structural motif]; Region: FR1"
                     /db_xref="CDD:409430"
     misc_feature    206..214
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409430"
     misc_feature    227..235
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409430"
     misc_feature    242..265
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409430"
     misc_feature    263..286
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="CDR1 [structural motif]; Region: CDR1"
                     /db_xref="CDD:409430"
     misc_feature    278..280
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9UQ74.2); glycosylation site"
     misc_feature    287..304
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="FR2 [structural motif]; Region: FR2"
                     /db_xref="CDD:409430"
     misc_feature    287..301
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409430"
     misc_feature    305..370
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="CDR2 [structural motif]; Region: CDR2"
                     /db_xref="CDD:409430"
     misc_feature    329..346
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409430"
     misc_feature    359..370
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409430"
     misc_feature    389..469
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="FR3 [structural motif]; Region: FR3"
                     /db_xref="CDD:409430"
     misc_feature    389..406
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409430"
     misc_feature    407..409
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9UQ74.2); glycosylation site"
     misc_feature    410..424
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409430"
     misc_feature    <416..535
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:448366"
     misc_feature    428..430
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9UQ74.2); glycosylation site"
     misc_feature    452..469
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409430"
     misc_feature    452..469
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    512..523
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    539..805
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Immunoglobulin (Ig)-like domain of human
                     carcinoembryonic antigen (CEA) related cell adhesion
                     molecule (CEACAM) domains 2, 4, and 6, and similar
                     domains; Region: IgI_hCEACAM_2_4_6_like; cd05740"
                     /db_xref="CDD:409402"
     misc_feature    539..553
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409402"
     misc_feature    560..577
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409402"
     misc_feature    590..610
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409402"
     misc_feature    629..646
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409402"
     misc_feature    650..661
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409402"
     misc_feature    671..685
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409402"
     misc_feature    692..709
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409402"
     misc_feature    692..694
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9UQ74.2); glycosylation site"
     misc_feature    737..763
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409402"
     misc_feature    773..802
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409402"
     misc_feature    818..1084
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:448366"
     misc_feature    869..883
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    899..901
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9UQ74.2); glycosylation site"
     misc_feature    908..922
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    974..988
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1004..1006
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q9UQ74.2); glycosylation site"
     misc_feature    1016..1033
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1061..1072
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1109..1336
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Fifth immunoglobulin (Ig)-like domain of the
                     carcinoembryonic antigen (CEA) related cell adhesion
                     molecule 5 (CEACAM5) and similar domains; member of the
                     C2-set IgSF domains; Region: IgC2_CEACAM5-like; cd20948"
                     /db_xref="CDD:409540"
     misc_feature    1109..1129
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409540"
     misc_feature    1142..1165
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409540"
     misc_feature    1181..1201
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409540"
     misc_feature    1208..1225
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409540"
     misc_feature    1232..1252
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409540"
     misc_feature    1259..1294
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409540"
     misc_feature    1301..1336
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409540"
     variation       99
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779444955"
     variation       102
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438136880"
     variation       103
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249770616"
     variation       104
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757986183"
     variation       105
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373909679"
     variation       106
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753133021"
     variation       109
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970197941"
     variation       111
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1970197879"
     variation       112
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1233195923"
     variation       114..117
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1970197640"
     variation       114
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970197757"
     variation       115
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342394703"
     variation       117
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461217760"
     variation       120
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146791116"
     variation       121
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240231787"
     variation       122
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2122294398"
     variation       123
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759960457"
     variation       126..132
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="cacagcg"
                     /replace="tgcagca"
                     /db_xref="dbSNP:71337226"
     variation       126..127
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ca"
                     /replace="tg"
                     /db_xref="dbSNP:34129574"
     variation       126
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7245423"
     variation       127
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62112127"
     variation       128
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763084223"
     variation       129
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970196999"
     variation       130
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773403623"
     variation       131
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200221981"
     variation       132
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7260508"
     variation       133
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768581313"
     variation       134
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1307105432"
     variation       136
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470392320"
     variation       137
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422500289"
     variation       138
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142949326"
     variation       139
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757952650"
     variation       142
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2122294173"
     variation       144
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010143443"
     variation       145
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61393109"
     variation       147
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756998284"
     variation       149
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145793435"
     variation       151
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369084125"
     variation       153
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755427646"
     variation       154
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1647959059"
     variation       154
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752003225"
     variation       159
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970195709"
     variation       160
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1970195660"
     variation       161
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259453451"
     exon            162..527
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /inference="alignment:Splign:2.1.0"
     variation       162
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535101367"
     variation       163
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145150049"
     variation       164
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774397715"
     variation       165
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185009634"
     variation       167
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175188799"
     variation       168
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1288395334"
     variation       171
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762332676"
     variation       172
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1600422980"
     variation       174
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970158077"
     variation       175
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970158020"
     variation       176
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1970157966"
     variation       177
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424955121"
     variation       179
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970157857"
     variation       181
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970157790"
     variation       184
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772784497"
     variation       185
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370580594"
     variation       186
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747823988"
     variation       187
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558478881"
     variation       189
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189448744"
     variation       190
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149617852"
     variation       191
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779346165"
     variation       192
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757810717"
     variation       193
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370832692"
     variation       194
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1970157150"
     variation       195
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1970157093"
     variation       196
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417553162"
     variation       200
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147359969"
     variation       201
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756202280"
     variation       203
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217298903"
     variation       207
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142689447"
     variation       208
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556036611"
     variation       210
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75687580"
     variation       211
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762961901"
     variation       212
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314145483"
     variation       213
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340426418"
     variation       214
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773081290"
     variation       215
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764803115"
     variation       216..218
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1970156326"
     variation       218
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150588080"
     variation       221
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2122286020"
     variation       222
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768322602"
     variation       223..224
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1970156003"
     variation       224
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141761918"
     variation       226
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148036395"
     variation       229
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198821989"
     variation       230
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:749822114"
     variation       230
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749785146"
     variation       231
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377659143"
     variation       233
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568380802"
     variation       234
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970155426"
     variation       235
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778209745"
     variation       236
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239842104"
     variation       238..241
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1254488894"
     variation       238
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970155237"
     variation       239
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756187432"
     variation       240
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781513768"
     variation       241
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395343370"
     variation       242
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970154929"
     variation       244
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572751671"
     variation       247
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74660622"
     variation       248
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307436156"
     variation       249..255
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ttct"
                     /replace="ttcttct"
                     /db_xref="dbSNP:1414897001"
     variation       249
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1333962137"
     variation       253
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227748402"
     variation       254
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348531351"
     variation       255
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:571272164"
     variation       256
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164169002"
     variation       257
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1459813898"
     variation       259
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1820550756"
     variation       260
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758194328"
     variation       262
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300725850"
     variation       263
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970153955"
     variation       265
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:551436858"
     variation       267
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765140265"
     variation       268
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761266960"
     variation       271
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138853785"
     variation       273
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970153584"
     variation       274
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219105523"
     variation       275
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970153473"
     variation       277
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760330897"
     variation       278
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381564211"
     variation       280
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1970153256"
     variation       284
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201774677"
     variation       285
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267590891"
     variation       286
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763266798"
     variation       287
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773746520"
     variation       289
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188574591"
     variation       290
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770223171"
     variation       292
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268582716"
     variation       293
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570388501"
     variation       294
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475457335"
     variation       295
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149135211"
     variation       298
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768915559"
     variation       299
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327041262"
     variation       301
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:547950171"
     variation       301
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138118337"
     variation       302
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327032815"
     variation       303
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2122285204"
     variation       305
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758194763"
     variation       306
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750210420"
     variation       307
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778872603"
     variation       308
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757187752"
     variation       311
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970151789"
     variation       312
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753285468"
     variation       313
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752363136"
     variation       315
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767124095"
     variation       316
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763326638"
     variation       317
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970151392"
     variation       318
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970151328"
     variation       319
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773480083"
     variation       320
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770369152"
     variation       321
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762398728"
     variation       323
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970151031"
     variation       325
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172593380"
     variation       326
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265866622"
     variation       331
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970150916"
     variation       332
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1970150846"
     variation       334
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429147215"
     variation       335
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777344894"
     variation       337
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768825721"
     variation       339
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970150613"
     variation       340..371
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="atatg"
                     /replace="atatgtagtagacggtcaaataattatatatg"
                     /db_xref="dbSNP:1970148943"
     variation       340
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463386375"
     variation       341
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747139040"
     variation       343
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7255419"
     variation       344
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7255518"
     variation       345
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970150215"
     variation       346
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2122284773"
     variation       347
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263560252"
     variation       348
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229019316"
     variation       350
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141265232"
     variation       352
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753766127"
     variation       353
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76352186"
     variation       354
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373735316"
     variation       356..357
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="tgt"
                     /db_xref="dbSNP:1420787209"
     variation       356
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755597560"
     variation       357..362
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="aa"
                     /replace="aaataa"
                     /db_xref="dbSNP:756254977"
     variation       358..363
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="aat"
                     /replace="aataat"
                     /db_xref="dbSNP:1399255211"
     variation       358
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:938657320"
     variation       359
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1296471644"
     variation       360
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75257969"
     variation       361..362
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="tgt"
                     /db_xref="dbSNP:1477434939"
     variation       363..364
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="acagtgta"
                     /db_xref="dbSNP:1377843509"
     variation       363
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1600422366"
     variation       365
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1476644894"
     variation       365
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200470633"
     variation       366
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767156163"
     variation       368
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114913961"
     variation       371..373
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:750586023"
     variation       371
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368446510"
     variation       372
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970148818"
     variation       373
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765694653"
     variation       374
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568380571"
     variation       375
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970148563"
     variation       376
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373148587"
     variation       379
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7256456"
     variation       380
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970148405"
     variation       381
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760771531"
     variation       382
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775439993"
     variation       383
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265194624"
     variation       384
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367918383"
     variation       385
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746061706"
     variation       386
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774618783"
     variation       387
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770678423"
     variation       389
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146950952"
     variation       390
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142736244"
     variation       391
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1714531125"
     variation       392
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780555542"
     variation       395
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329641812"
     variation       396
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1970147682"
     variation       398
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149961067"
     variation       399
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751141317"
     variation       401
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370099262"
     variation       403
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049355172"
     variation       404
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1970147270"
     variation       408
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766184721"
     variation       409
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553890173"
     variation       410
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764632234"
     variation       411
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761102569"
     variation       413
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375708199"
     variation       415
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482587874"
     variation       416
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370490968"
     variation       418
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970146805"
     variation       422
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401031119"
     variation       423
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="t"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1362978565"
     variation       424..427
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="ccag"
                     /db_xref="dbSNP:1472860385"
     variation       424
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568380487"
     variation       428..429
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1176956587"
     variation       428
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441932680"
     variation       429
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970146369"
     variation       431
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250490946"
     variation       432
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1202433046"
     variation       433
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486344362"
     variation       435
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379936879"
     variation       436..438
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="cca"
                     /db_xref="dbSNP:1281631626"
     variation       436
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115679481"
     variation       437
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771163131"
     variation       438
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77134863"
     variation       439
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336015640"
     variation       440
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772994342"
     variation       441..442
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1235660099"
     variation       441
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350438707"
     variation       442
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79378816"
     variation       443
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568380447"
     variation       444
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748032206"
     variation       445
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781232973"
     variation       446
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1412978319"
     variation       446
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746544244"
     variation       448..449
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1160063307"
     variation       448
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399850655"
     variation       449..450
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1205680517"
     variation       450
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779816799"
     variation       453..454
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1970144606"
     variation       453..454
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:11355507"
     variation       453
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:190921232"
     variation       454
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1970144396"
     variation       457
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778265919"
     variation       458
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756565747"
     variation       459
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753108890"
     variation       460
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186480712"
     variation       461
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768115204"
     variation       463
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285859853"
     variation       464
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759484117"
     variation       466
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488967222"
     variation       467
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751670103"
     variation       468
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1600421907"
     variation       469
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138900265"
     variation       470
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235666152"
     variation       471
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005433361"
     variation       473
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146093517"
     variation       474
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141872267"
     variation       475
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328446571"
     variation       476
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148091598"
     variation       479
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1970143105"
     variation       480
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970143044"
     variation       481
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435549632"
     variation       482
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895132510"
     variation       484
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2122283509"
     variation       485
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768673447"
     variation       486
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746456815"
     variation       487
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779728700"
     variation       489
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771769482"
     variation       491
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471501983"
     variation       492
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369659318"
     variation       494
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970142432"
     variation       495
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338094472"
     variation       497
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778663769"
     variation       498
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464777605"
     variation       500
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1970142141"
     variation       501
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970142074"
     variation       502
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116767543"
     variation       504
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753125487"
     variation       505
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527880082"
     variation       506
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751580404"
     variation       507
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1226712137"
     variation       508
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341478494"
     variation       509
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766432917"
     variation       510
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227923321"
     variation       512
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763061504"
     variation       513
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318257494"
     variation       514
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750621396"
     variation       515
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2122283225"
     variation       517
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376789797"
     variation       518
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1970141170"
     variation       519
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761475929"
     variation       520
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1970141021"
     variation       521
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776491877"
     variation       522
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372958378"
     variation       523
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168911811"
     variation       525
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448471701"
     variation       526
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7255164"
     variation       527
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466865677"
     exon            528..806
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /inference="alignment:Splign:2.1.0"
     variation       528
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779332335"
     variation       529
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771018602"
     variation       531
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:558757365"
     variation       532
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778098439"
     variation       538
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969983813"
     variation       540
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969983757"
     variation       541
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538452549"
     variation       542..547
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="cc"
                     /replace="ccctcc"
                     /db_xref="dbSNP:1433291072"
     variation       542
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142534823"
     variation       543
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140447066"
     variation       546
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536270387"
     variation       549
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766251497"
     variation       550
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149695044"
     variation       551
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969982999"
     variation       552
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867607684"
     variation       556
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749942568"
     variation       557
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366781239"
     variation       560..562
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1423323095"
     variation       562
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764813765"
     variation       566
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375466268"
     variation       568
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140758943"
     variation       570
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187722601"
     variation       571
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383101071"
     variation       572
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449691728"
     variation       573
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426474877"
     variation       574
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969982055"
     variation       575
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150936706"
     variation       576
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355111172"
     variation       577
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969981875"
     variation       578
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771369931"
     variation       579..580
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:763998736"
     variation       579
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371839942"
     variation       581
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568376851"
     variation       582
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778012119"
     variation       583
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770054634"
     variation       584
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535298341"
     variation       586
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781603858"
     variation       587
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754754255"
     variation       589
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1333133667"
     variation       591
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969981028"
     variation       592
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969980934"
     variation       594
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751341959"
     variation       595
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1309994977"
     variation       595
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758282363"
     variation       598
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750421440"
     variation       599
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116389883"
     variation       600
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142497726"
     variation       601
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969980396"
     variation       607
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139444715"
     variation       608
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759901877"
     variation       609
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969980140"
     variation       611
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146269254"
     variation       613
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406457514"
     variation       615
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:967623353"
     variation       617
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771409114"
     variation       618
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331848688"
     variation       619
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187064013"
     variation       620
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773921328"
     variation       622
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143424985"
     variation       623
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532578985"
     variation       627
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483061049"
     variation       628
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1273487928"
     variation       630
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1600411740"
     variation       632
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183657521"
     variation       633
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347655808"
     variation       634
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779703066"
     variation       635
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758282702"
     variation       636
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969978816"
     variation       637
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969978750"
     variation       638
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278233047"
     variation       639..640
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1290712247"
     variation       639
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549833586"
     variation       640
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778873646"
     variation       643
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756703739"
     variation       644
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1249635757"
     variation       648
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753374011"
     variation       649
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763733366"
     variation       650
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969978137"
     variation       655
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139925716"
     variation       657
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752451004"
     variation       659
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478910703"
     variation       660
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766646869"
     variation       662
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763450783"
     variation       663
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401083208"
     variation       664
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773833315"
     variation       665
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145990413"
     variation       666
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761918495"
     variation       670
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368241270"
     variation       671
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776589569"
     variation       673
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768840904"
     variation       674
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267605519"
     variation       675
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775825555"
     variation       676
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1600411547"
     variation       677
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370640395"
     variation       678
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745689620"
     variation       679
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1321769610"
     variation       680
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79897706"
     variation       681
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229533476"
     variation       682
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138201287"
     variation       683
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757187521"
     variation       684
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748734736"
     variation       685
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777131876"
     variation       686
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755714443"
     variation       690
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752258674"
     variation       691
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146641163"
     variation       693
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451670664"
     variation       694
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767372250"
     variation       696
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263037383"
     variation       697
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322551149"
     variation       698
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457671748"
     variation       699
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1410645787"
     variation       700
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777263751"
     variation       701
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764052314"
     variation       703
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760861543"
     variation       704
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969975327"
     variation       706
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170157549"
     variation       707
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373585002"
     variation       708
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2122248446"
     variation       709
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772315876"
     variation       710
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192338151"
     variation       711
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969975054"
     variation       712
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116299426"
     variation       713
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770768411"
     variation       714
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1209957795"
     variation       717
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545223763"
     variation       720
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777804512"
     variation       723
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969974690"
     variation       724
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377706171"
     variation       725
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357078899"
     variation       727
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779209108"
     variation       728
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2122248237"
     variation       729
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2122248223"
     variation       731
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751315814"
     variation       733
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969974252"
     variation       734
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380354144"
     variation       735
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322269908"
     variation       737
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327456298"
     variation       738
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217784155"
     variation       741
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435477209"
     variation       742
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1969973769"
     variation       743
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344564544"
     variation       744
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1295729514"
     variation       754
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374584397"
     variation       755
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141410321"
     variation       756
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139399276"
     variation       760
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146905361"
     variation       761
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144055035"
     variation       763
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:372980211"
     variation       763
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1600411157"
     variation       764
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371313519"
     variation       765
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759738109"
     variation       768
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1969972803"
     variation       768
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:967991530"
     variation       769
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770680437"
     variation       770
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189646092"
     variation       771
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449174237"
     variation       775
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772973031"
     variation       776
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138487637"
     variation       777
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747553898"
     variation       778
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289206727"
     variation       780
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969972020"
     variation       781
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220596852"
     variation       782
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455930199"
     variation       784..786
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1360940727"
     variation       784
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1344607151"
     variation       785
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780837177"
     variation       786
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768349850"
     variation       788
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143748376"
     variation       790
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779904614"
     variation       792
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1256135479"
     variation       793
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754264222"
     variation       795
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302014848"
     variation       798
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553846287"
     variation       799
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969971024"
     variation       800
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969970954"
     variation       803
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2122247544"
     variation       804
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756654089"
     variation       806
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753198802"
     exon            807..1085
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /inference="alignment:Splign:2.1.0"
     variation       807
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780177782"
     variation       808
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758446289"
     variation       812
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985811256"
     variation       815..817
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1314551055"
     variation       815
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750634211"
     variation       816
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969894689"
     variation       819
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765397920"
     variation       820
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953187297"
     variation       821
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199823950"
     variation       823
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969894276"
     variation       824
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228529789"
     variation       825
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757075624"
     variation       826
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753687202"
     variation       827
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923011961"
     variation       829
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2122236955"
     variation       830..838
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ac"
                     /replace="accatcaac"
                     /db_xref="dbSNP:764623194"
     variation       830
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645031075"
     variation       831
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370276579"
     variation       832
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752752664"
     variation       833
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767025509"
     variation       835..841
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="caacaac"
                     /replace="caacaacaac"
                     /db_xref="dbSNP:1207829854"
     variation       835
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451794178"
     variation       837
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528667542"
     variation       838
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774007363"
     variation       839
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380077196"
     variation       840
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78350496"
     variation       841
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769075478"
     variation       842
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286604547"
     variation       843
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780473816"
     variation       844
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451021979"
     variation       846
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772140769"
     variation       847
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:532388978"
     variation       849
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969892271"
     variation       850
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484645075"
     variation       851
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969892120"
     variation       852
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183213783"
     variation       853
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266662840"
     variation       854
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222833818"
     variation       856
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144938138"
     variation       858
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969891738"
     variation       859
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1600406795"
     variation       860
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1159808386"
     variation       861
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358312519"
     variation       862
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224552667"
     variation       863
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779121780"
     variation       864
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757563975"
     variation       866
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1366363816"
     variation       870
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969891056"
     variation       872
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754167064"
     variation       873
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777710774"
     variation       874
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756016570"
     variation       875
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:894494535"
     variation       877
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752661524"
     variation       878
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370986372"
     variation       879
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759047700"
     variation       880
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969890450"
     variation       882
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431457796"
     variation       883
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969890305"
     variation       884
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2122236515"
     variation       887
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373423846"
     variation       888
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751037122"
     variation       891
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765998483"
     variation       894
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969889966"
     variation       896
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140231543"
     variation       904
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772891067"
     variation       905
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761048202"
     variation       906
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745899134"
     variation       909
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969889462"
     variation       910
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543391467"
     variation       911
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146653609"
     variation       912
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749493177"
     variation       913
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225643089"
     variation       915..916
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:759137475"
     variation       915
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778192434"
     variation       916
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969888842"
     variation       919
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426365387"
     variation       920
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755926501"
     variation       921
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752468754"
     variation       924
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781118462"
     variation       926
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375688393"
     variation       927
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751572740"
     variation       928
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466330389"
     variation       931
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765843579"
     variation       932
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1374731182"
     variation       933
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374595113"
     variation       934
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374769387"
     variation       936
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:560841302"
     variation       937
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761032137"
     variation       939
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775728209"
     variation       940
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541230835"
     variation       946
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940413217"
     variation       947
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365177236"
     variation       949
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774966862"
     variation       950
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969887217"
     variation       951
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771117205"
     variation       952
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484406485"
     variation       953
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749405027"
     variation       955..957
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1322474829"
     variation       955
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969886992"
     variation       958
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907666049"
     variation       959
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773530892"
     variation       960
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113087470"
     variation       961
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747919964"
     variation       962
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780835798"
     variation       963
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746897583"
     variation       966
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200400261"
     variation       968
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953014149"
     variation       969
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2122236035"
     variation       973
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202164066"
     variation       974
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1285296408"
     variation       975
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572099259"
     variation       976
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867195556"
     variation       978
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757862245"
     variation       979
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749936665"
     variation       982
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427058111"
     variation       986
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969885823"
     variation       990
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409400000"
     variation       993
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764809746"
     variation       999
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558641447"
     variation       1000
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544743837"
     variation       1003
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969885426"
     variation       1006
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767745515"
     variation       1011
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2122235917"
     variation       1012
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438518130"
     variation       1013
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969885282"
     variation       1014
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759998253"
     variation       1016
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1244091627"
     variation       1017
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203639027"
     variation       1018
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460387761"
     variation       1021
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774953276"
     variation       1022
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205794631"
     variation       1024
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350030021"
     variation       1026
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969884730"
     variation       1027
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142609328"
     variation       1030
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1568374431"
     variation       1031
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763060753"
     variation       1034
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372083751"
     variation       1035
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315501297"
     variation       1036
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194683193"
     variation       1037
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451596557"
     variation       1038
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769974448"
     variation       1039
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776959430"
     variation       1040
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768287272"
     variation       1041
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11879884"
     variation       1045
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745861236"
     variation       1047
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143061243"
     variation       1050
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756828271"
     variation       1051
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753413480"
     variation       1052
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443090258"
     variation       1053
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1600406198"
     variation       1055
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200167716"
     variation       1056
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140722778"
     variation       1058
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446541669"
     variation       1059
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301184661"
     variation       1060..1061
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:776136827"
     variation       1060
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751980064"
     variation       1061
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111674083"
     variation       1062
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969882349"
     variation       1063
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291232906"
     variation       1065
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940398489"
     variation       1067
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244996770"
     variation       1068
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568374324"
     variation       1069
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765207960"
     variation       1071
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376880595"
     variation       1072
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2122235467"
     variation       1073
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776675549"
     variation       1075
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768926626"
     variation       1078
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969881608"
     variation       1082
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760402112"
     variation       1083
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425962268"
     exon            1086..1340
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /inference="alignment:Splign:2.1.0"
     variation       1086
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969867799"
     variation       1087
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224989568"
     variation       1088
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536269041"
     variation       1089
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770908424"
     variation       1090
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748692125"
     variation       1091
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969867386"
     variation       1092
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1741041617"
     variation       1094
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772767775"
     variation       1095
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969867220"
     variation       1096
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377240511"
     variation       1097
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138526624"
     variation       1099
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375082156"
     variation       1101
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969866812"
     variation       1105
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018693425"
     variation       1111
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758796006"
     variation       1113
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969866584"
     variation       1115
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969866506"
     variation       1116
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969866439"
     variation       1117
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353121755"
     variation       1120
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339309377"
     variation       1122
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150464724"
     variation       1123
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779228247"
     variation       1125
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141515836"
     variation       1130..1131
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="cg"
                     /db_xref="dbSNP:1169798347"
     variation       1130
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757765664"
     variation       1131
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148019273"
     variation       1132
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764199390"
     variation       1133
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1469497887"
     variation       1135..1139
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:749723624"
     variation       1136
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230942496"
     variation       1137
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756231515"
     variation       1138
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969865295"
     variation       1141
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752870751"
     variation       1142
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1064489"
     variation       1143
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1064490"
     variation       1144
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1307351344"
     variation       1145
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406472449"
     variation       1148
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300919358"
     variation       1151
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774211789"
     variation       1153
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766147229"
     variation       1155
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762945492"
     variation       1156
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969864311"
     variation       1157
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551641047"
     variation       1158
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568373675"
     variation       1159
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317634029"
     variation       1161
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453780078"
     variation       1164
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769407964"
     variation       1165
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747690807"
     variation       1166
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373734899"
     variation       1168
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116480924"
     variation       1170
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969863554"
     variation       1171
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969863481"
     variation       1173
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158716488"
     variation       1175
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969863332"
     variation       1176
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1600405021"
     variation       1177
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969863183"
     variation       1178
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779329080"
     variation       1179
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757599628"
     variation       1180
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1058758"
     variation       1181
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444950954"
     variation       1184
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1058763"
     variation       1185
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146672854"
     variation       1186
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752782848"
     variation       1187
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892021477"
     variation       1190
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368908706"
     variation       1191
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969862270"
     variation       1192
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969862190"
     variation       1193
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054746002"
     variation       1195
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755183019"
     variation       1197
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568373575"
     variation       1199
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969861837"
     variation       1201
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969861771"
     variation       1202
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751797895"
     variation       1203
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542714417"
     variation       1205
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247193012"
     variation       1206
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766168104"
     variation       1207
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762706287"
     variation       1209
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773159611"
     variation       1210
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765268200"
     variation       1211
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288395818"
     variation       1216
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761349940"
     variation       1218
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367696932"
     variation       1219
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776266928"
     variation       1220
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114673766"
     variation       1221
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1384341498"
     variation       1224
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141151331"
     variation       1225
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775051339"
     variation       1227
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:974719797"
     variation       1229
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969860286"
     variation       1231
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775456119"
     variation       1232
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969860210"
     variation       1233
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771274488"
     variation       1234
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749649602"
     variation       1237
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969859946"
     variation       1240..1244
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:780656185"
     variation       1241
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969859887"
     variation       1242
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778188699"
     variation       1244
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770302624"
     variation       1245
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568373467"
     variation       1246
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:116682333"
     variation       1247
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751785407"
     variation       1249
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376501776"
     variation       1252
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758143768"
     variation       1253
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750196314"
     variation       1258
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:950604642"
     variation       1259
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184351465"
     variation       1260
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765182014"
     variation       1261
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761836748"
     variation       1262
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568373417"
     variation       1263
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404539598"
     variation       1264
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753863481"
     variation       1265
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149943830"
     variation       1267
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566992814"
     variation       1268
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775165084"
     variation       1269..1277
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="tctatgctt"
                     /replace="tctatgcttctatgctt"
                     /db_xref="dbSNP:1336866372"
     variation       1270
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771631368"
     variation       1272
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373062276"
     variation       1273..1280
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="tgct"
                     /replace="tgcttgct"
                     /db_xref="dbSNP:769747759"
     variation       1273
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430752317"
     variation       1274
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969857933"
     variation       1275
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382246325"
     variation       1278
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370144520"
     variation       1279
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407633030"
     variation       1282
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139148701"
     variation       1286
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375725440"
     variation       1287
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151185117"
     variation       1290
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251306336"
     variation       1291
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350315441"
     variation       1292
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217301565"
     variation       1295
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747091663"
     variation       1296
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338160468"
     variation       1297
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204512737"
     variation       1301..1302
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:746023465"
     variation       1301
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284031249"
     variation       1302
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1222942685"
     variation       1303
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255301940"
     variation       1305
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372480345"
     variation       1307
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969856252"
     variation       1309
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969856164"
     variation       1311
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200488282"
     variation       1314
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:891936994"
     variation       1315
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969855937"
     variation       1318
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1600404468"
     variation       1319
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969855788"
     variation       1322
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969855706"
     variation       1323
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568373317"
     variation       1324
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144735943"
     variation       1325
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757163453"
     variation       1326
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753777211"
     variation       1328
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969855243"
     variation       1329
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969855163"
     variation       1330..1333
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1302792592"
     variation       1330
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140787148"
     variation       1331
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752164628"
     variation       1334
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568373281"
     variation       1335
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176524770"
     variation       1340
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479790039"
     exon            1341..2031
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /inference="alignment:Splign:2.1.0"
     variation       1343
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751557759"
     variation       1345
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756918298"
     variation       1346
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776998124"
     variation       1347
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753503327"
     variation       1348
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781668606"
     variation       1349
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755445760"
     variation       1351
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752067949"
     variation       1352
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188113038"
     variation       1353
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758343639"
     variation       1354
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1301202083"
     variation       1355
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2122228307"
     variation       1361
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542861264"
     variation       1362
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750531585"
     variation       1365
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765293518"
     variation       1366
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277169996"
     variation       1367
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:553477524"
     variation       1367
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762062469"
     variation       1368
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776886149"
     variation       1369
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763826204"
     variation       1370
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378225386"
     variation       1371
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760490169"
     variation       1372
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969828374"
     variation       1373
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199501013"
     variation       1374
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201922032"
     variation       1375
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745847726"
     variation       1377
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1486552060"
     variation       1379
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773910144"
     variation       1380
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770390890"
     variation       1388
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748952588"
     variation       1389
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294435517"
     variation       1390
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755355428"
     variation       1391
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321648388"
     variation       1392
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969827672"
     variation       1393
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747384316"
     variation       1394
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780651182"
     variation       1395
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969827528"
     variation       1396
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1362711658"
     variation       1398
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969827425"
     variation       1399
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758932998"
     variation       1401
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149721508"
     variation       1404
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757305607"
     variation       1405..1409
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1158002541"
     variation       1406
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184518374"
     variation       1407
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296199120"
     variation       1408
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969826957"
     variation       1409..1412
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="agac"
                     /db_xref="dbSNP:1969826778"
     variation       1410
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969826872"
     variation       1411
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006720785"
     variation       1412
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1468652536"
     variation       1414
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367570772"
     variation       1415..1416
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1969826641"
     variation       1415
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969826693"
     variation       1416
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192494501"
     variation       1418
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300290278"
     variation       1419
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969826419"
     variation       1419
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1204704574"
     variation       1420
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1340426425"
     variation       1421..1422
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1969826281"
     variation       1421
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568372571"
     variation       1428
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290787234"
     variation       1429
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969826194"
     variation       1430
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:80050376"
     variation       1432
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444427944"
     variation       1434
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029278748"
     variation       1435
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969825979"
     variation       1437
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969825926"
     variation       1440
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969825878"
     variation       1441
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241632548"
     variation       1442
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371523500"
     variation       1444
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189090951"
     variation       1445
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1391789334"
     variation       1456
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465690545"
     variation       1458
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447378647"
     variation       1465
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167098376"
     variation       1466
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414158788"
     variation       1468
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038153030"
     variation       1469
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321063428"
     variation       1470
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969825417"
     variation       1471
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969825378"
     variation       1472
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941122028"
     variation       1473
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1436499534"
     variation       1474
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:887922480"
     variation       1477
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1284467258"
     variation       1478
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:558233510"
     variation       1482
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879586492"
     variation       1484
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969825041"
     variation       1485
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969824989"
     variation       1486
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285149273"
     variation       1487
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969824892"
     variation       1490
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045260648"
     variation       1491
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969824777"
     variation       1492
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:8100679"
     variation       1493
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948251195"
     variation       1495
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249889144"
     variation       1500
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1435736728"
     variation       1501
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192258621"
     variation       1502
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344608147"
     variation       1507
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569186357"
     variation       1511
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316103491"
     variation       1512
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918211943"
     variation       1513
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:796273310"
     variation       1514
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935373418"
     variation       1515
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969824144"
     variation       1516
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:796618267"
     variation       1518
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969824032"
     variation       1519
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555655343"
     variation       1522
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968105500"
     variation       1523
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018027052"
     variation       1526
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188167768"
     variation       1527
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1230386357"
     variation       1529
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266285076"
     variation       1534
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327060451"
     variation       1537
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566626116"
     variation       1538
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546462782"
     variation       1539
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450467991"
     variation       1541
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1600402320"
     variation       1545
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2122227578"
     variation       1546
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1600402316"
     variation       1548
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969823443"
     variation       1550
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184975541"
     variation       1552
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:994227157"
     variation       1553
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472710608"
     variation       1556
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969823289"
     variation       1557
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:533076275"
     variation       1558..1561
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ggac"
                     /replace="ggacggac"
                     /db_xref="dbSNP:1173604984"
     variation       1558
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409099247"
     variation       1560..1566
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1351381337"
     variation       1560
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453716748"
     variation       1562..1563
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1404818991"
     variation       1563
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969822986"
     variation       1564
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570208587"
     variation       1567
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411878937"
     variation       1568
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969822843"
     variation       1569
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550200968"
     variation       1570
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969822737"
     variation       1571
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289916532"
     variation       1577
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221302857"
     variation       1581
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238242783"
     variation       1582
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1356744747"
     variation       1583..1586
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1256453585"
     variation       1585
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969822507"
     variation       1587
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347015857"
     variation       1588
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969822356"
     variation       1589
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1198583991"
     variation       1592
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969822262"
     variation       1594
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969822204"
     variation       1597
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279300047"
     variation       1598
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:905619354"
     variation       1599..1614
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="caagatgtcagaacaa"
                     /replace="caagatgtcagaacaacaagatgtcagaacaa"
                     /db_xref="dbSNP:1969821827"
     variation       1599
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969822058"
     variation       1602
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045255453"
     variation       1603
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1248991362"
     variation       1609
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530383727"
     variation       1612
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268370812"
     variation       1616
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1198938186"
     variation       1622
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969821755"
     variation       1626
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:896725669"
     variation       1629
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1477309860"
     variation       1630
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056689430"
     variation       1631
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969821593"
     variation       1634
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438457639"
     variation       1635
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431892439"
     variation       1636
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969821439"
     variation       1637
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969821388"
     variation       1640
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562845772"
     variation       1641
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387481876"
     variation       1643
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969821231"
     variation       1644
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:923923457"
     variation       1649
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1303766985"
     variation       1650
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1600402164"
     variation       1651
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969821043"
     variation       1652
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231964298"
     variation       1653
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404405468"
     variation       1654
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969820841"
     variation       1655
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:979847108"
     variation       1656
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230178998"
     variation       1659
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364006483"
     variation       1663
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1731096412"
     variation       1665
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969820666"
     variation       1667
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:946792845"
     variation       1668
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911347525"
     variation       1672
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209958269"
     variation       1673
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:985244342"
     variation       1676
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969820481"
     variation       1677
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450420741"
     variation       1681
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969820405"
     variation       1682
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969820352"
     variation       1683
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969820299"
     variation       1684
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193521092"
     variation       1686
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430847062"
     variation       1687
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419205192"
     variation       1689
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166685804"
     variation       1692
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969820032"
     variation       1698
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969819990"
     variation       1703
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372788606"
     variation       1705
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969819892"
     variation       1707
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969819850"
     variation       1711
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1600402105"
     variation       1713
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1458574692"
     variation       1716
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568372304"
     variation       1718
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969819683"
     variation       1720
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295410436"
     variation       1721
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969819592"
     variation       1726
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543274895"
     variation       1729
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955237718"
     variation       1730
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969819473"
     variation       1734
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969819423"
     variation       1737
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:529478127"
     variation       1741
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969819301"
     variation       1742
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306612286"
     variation       1747
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245010414"
     variation       1751
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969819144"
     variation       1752
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969819097"
     variation       1754
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969819064"
     variation       1755
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1600402064"
     variation       1757
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353560186"
     variation       1764
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:961593083"
     variation       1768
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1969818848"
     variation       1768
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184905131"
     variation       1769..1772
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1205374831"
     variation       1773..1774
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="tct"
                     /replace="tctcaaccatctcaacc"
                     /db_xref="dbSNP:377417293"
     variation       1774
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867121094"
     variation       1775
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868329145"
     variation       1776
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1167129429"
     variation       1779
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969818417"
     variation       1780
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366812876"
     variation       1781
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969818311"
     variation       1785..1786
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1969818210"
     variation       1785
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969818262"
     variation       1787
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005257632"
     variation       1788
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159998621"
     variation       1789
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540446529"
     variation       1792
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145343959"
     variation       1793
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2122226802"
     variation       1797
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360969402"
     variation       1801
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372046484"
     variation       1802
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1314356262"
     variation       1803
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353160992"
     variation       1806
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969817827"
     variation       1808
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232219504"
     variation       1812
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969817746"
     variation       1813
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331901919"
     variation       1815
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1022748969"
     variation       1816
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544622272"
     variation       1817
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014026600"
     variation       1819
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183950168"
     variation       1820
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254416918"
     variation       1821
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139905455"
     variation       1822
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969817261"
     variation       1823
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150844587"
     variation       1825
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969817152"
     variation       1826
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999746466"
     variation       1828
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354333291"
     variation       1829
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902796468"
     variation       1830
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344396987"
     variation       1831
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043728764"
     variation       1833
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373278974"
     variation       1834
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969816754"
     variation       1836
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969816707"
     variation       1841
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969816652"
     variation       1847
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413764016"
     variation       1848
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969816549"
     variation       1849
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288451813"
     variation       1851
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574059218"
     variation       1852
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430689975"
     variation       1854
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7246152"
     variation       1855
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969816294"
     variation       1857
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212734281"
     variation       1859
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969816204"
     variation       1861
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934097326"
     variation       1863
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485481917"
     variation       1868
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113347815"
     variation       1872
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:193036086"
     variation       1873
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468618435"
     variation       1874
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969815925"
     variation       1876
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969815882"
     variation       1877
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553179997"
     variation       1878
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176672703"
     variation       1880
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182462710"
     variation       1881
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187443059"
     variation       1882
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969815610"
     variation       1883
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1178023326"
     variation       1886
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969815515"
     variation       1888
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:879801642"
     variation       1890
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969815409"
     variation       1893
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433747148"
     variation       1896
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969815309"
     variation       1897
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969815265"
     variation       1899
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114518895"
     variation       1900
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969815164"
     variation       1901
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969815127"
     variation       1904
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568372126"
     variation       1906
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442765588"
     variation       1907
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262477481"
     variation       1909..1911
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1347529930"
     variation       1909
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969683847"
     variation       1910
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372060994"
     variation       1911
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969814734"
     variation       1912
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1229435317"
     variation       1914
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1013972689"
     variation       1915..1916
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:1203960262"
     variation       1916
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1969814524"
     variation       1917
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:960063849"
     variation       1919
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1231841504"
     variation       1925
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969814446"
     variation       1927
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393041090"
     variation       1928
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453510390"
     variation       1930
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969814358"
     variation       1933
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1224551040"
     variation       1934
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035186270"
     variation       1935..1938
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="tgtg"
                     /replace="tgtgtg"
                     /db_xref="dbSNP:1349917176"
     variation       1935
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407836867"
     variation       1938..1939
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1969814127"
     variation       1939
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000140296"
     variation       1940
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969814009"
     variation       1941
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277993215"
     variation       1942
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374158106"
     variation       1943
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1600401748"
     variation       1944
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568372076"
     variation       1946
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969813767"
     variation       1948
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183070042"
     variation       1949
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368566805"
     variation       1951
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043985969"
     variation       1952
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436361103"
     variation       1953
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374485363"
     variation       1958
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969813425"
     variation       1959
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568372057"
     variation       1961
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1969813336"
     variation       1963
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300227627"
     variation       1965
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969813253"
     variation       1967
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969813218"
     variation       1968
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337749529"
     variation       1969
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1214152290"
     variation       1971
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390205515"
     variation       1976
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1304818760"
     variation       1977
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7245658"
     variation       1978
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889762821"
     variation       1981
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215501542"
     variation       1983
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969812787"
     variation       1984
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969812746"
     variation       1985
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1969812705"
     variation       1988
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251125768"
     variation       1989
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405400899"
     variation       1990
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049721313"
     variation       1993
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1445053050"
     variation       1994
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1969812466"
     variation       1996
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934057092"
     variation       2000
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243585856"
     variation       2002
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969812313"
     variation       2004
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969812263"
     variation       2005
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1969812212"
     variation       2008
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529617493"
     variation       2009
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2122226082"
     variation       2011
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1413909821"
     variation       2011
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7246644"
     variation       2012
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1600401633"
     variation       2013
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1600401626"
     variation       2015
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969811868"
     variation       2016
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462619069"
     variation       2018
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969811827"
     variation       2019
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148329713"
     variation       2020
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268690554"
     variation       2024
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1969811663"
     variation       2025
                     /gene="PSG8"
                     /gene_synonym="PSG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144318143"
ORIGIN      
agaaggaggcaggacagcactgctgagagctgtgctcaggaagcttctggatcctaggctcatctccacagaggagaacacacagacagcagagaccatggggctcctctcagcccctccctgcacacagcgcatcacctggaaggggctcctgctcacagcatcacttttaaacttctggaacccacccacgactgcccaagtcacgattgaagcccagccaaccaaagtttctgaggggaaggatgttcttctacttgtccacaatttgccccagaatcttactggctacatctggtacaaagggcaaatcagggacctctaccattacattacatcatatgtagtagacggtcaaataattatatatgggcctgcatacagtggacgagaaacaatatattccaatgcatccctgctgatccagaatgtcacccaggaagacgcaggatcctacaccttacacatcataatgggaggtgatgagaatagaggagtaactggacatttcaccttcaccttatatctggagactcccaagccctccatctccagcagcaaattaaaccccagggaggccatggaggctgtgagcttaacctgtgatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgtctcacaggttgcagttgtctgaaaccaacaggaccctctttctattgggtgtcacaaagtacactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccattcaccctgaatctcctcccgaagctgcccaagccctacatcaccatcaacaacttaaaacccagggagaataaggatgtcttaaacttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcgacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaataagggaccaatatggtggcatccgcagttacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccgttcaggagaagtcctctacttgtcctgttctgcggactctaacccaccggcacagtattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccaaattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcaaggaaagctccaaatccatgacagtaaaagtctctgactggacattaccctgaattctactagttcctccaattccattttcttccatggaatcgctaagaaaaagacccactctgttccagaagccctataagctggaggtggacaactcaatgtaaatttcatgggaaaacccttgtacctgaagggtgagccactcagaactcactaaaatgttcgacaccataacaacagatgctcaaactgtaaaccaggacaacaagtggatgacttcacactgtggacagtttttcccaagatgtcagaacaagactccccatcatgatgaggctctcacccctcttaactgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaatagagtgtcagatatgtcatctcaacccaaacttttacataacatctcagggggaaatgtggctctctccaccttgcatacaggactcccaatagaaatgaacacagagatattgcccgtgtgtttgcagataagatggtttctatgaagaggtaggaaagctgaaattataatagagtcccctttaaatgcacattctgtggatggctctcgccatttcctaagagatacattgtaaaatgtgacagtaatactgattctagcagaataaaacatgtaccacatttgctaatac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]