GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:58:20, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant X5, mRNA. (2976 bp)
gagtaaacaaacttatttctcattggcaaaaatgtgttgattgtaatggttcctattttaattaataaagatttgtgtgaacctagttataatgacttaaaattcatggtcccaaacagcaattacttttgcaccaaactaaaaatataagttaaaatggaagagtctaggagcaaaccaagaaaagatcacctacttcatcatctctggtcaaaaacaaaccaaaaaacttaacagctatcacttaagtttgcttcctagcaattatttagcttccagtctagattacaggatatataaaactttctttctttctttcttaactatgacactggcaccaatgagagtcctgtgactgactttcacatttccaccattactcaattactggtaccataccacctctaatcccctaaatcaaactgcaattcaacaataaagggcgtacagagatgactttgtcctgaaggaaaatgaatatccttgtaccctctatatagctaacttccaaatgtaagagaactatggggtaaccttttgtttctattcctatcaagatgagcctttaagagagggacttttattaagctcttgaccaag...
position 2388 2468 2521 2601 2618 2636 2650 2670 2685 2758 2770
Synonym: AGM1; IMD23; PAGM; PGM 3
XM_017010937.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant X1, mRNA. (3099 bp)
gagtaaacaaacttatttctcattggcaaaaatgtgttgattgtaatggttcctattttaattaataaagatttgtgtgaacctagttataatgacttaaaattcatggtcccaaacagcaattacttttgcaccaaactaaaaatataagttaaaatggaagagtctaggagcaaaccaagaaaagatcacctacttcatcatctctggtcaaaaacaaaccaaaaaacttaacagctatcacttaagtttgcttcctagcaattatttagcttccagtctagattacaggatatataaaactttctttctttctttcttaactatgacactggcaccaatgagagtcctgtgactgactttcacatttccaccattactcaattactggtaccataccacctctaatcccctaaatcaaactgcaattcaacaataaagggcgtacagagatgactttgtcctgaaggaaaatgaatatccttgtaccctctatatagctaacttccaaatgtaagagaactatggggtaaccttttgtttctattcctatcaagatgagcctttaagagagggacttttattaagctcttgaccaag...
position 2511 2591 2644 2724 2741 2759 2773 2793 2808 2881 2893
Synonym: AGM1; IMD23; PAGM; PGM 3
XM_017010935.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant 3, mRNA. (5877 bp)
gagtaaacaaacttatttctcattggcaaaaatgtgttgattgtaatggttcctattttaattaataaagatttgtgtgaacctagttataatgacttaaaattcatggtcccaaacagcaattacttttgcaccaaactaaaaatataagttaaaatggaagagtctaggagcaaaccaagaaaagatcacctacttcatcatctctggtcaaaaacaaaccaaaaaacttaacagctatcacttaagtttgcttcctagcaattatttagcttccagtctagattacaggatatataaaactttctttctttctttcttaactatgacactggcaccaatgagagtcctgtgactgactttcacatttccaccattactcaattactggtaccataccacctctaatcccctaaatcaaactgcaattcaacaataaagggcgtacagagatgactttgtcctgaaggaaaatgaatatccttgtaccctctatatagctaacttccaaatgtaagagaactatggggtaaccttttgtttctattcctatcaagatgagcctttaagagagggacttttattaagctcttgaccaag...
position 5289 5369 5422 5502 5519 5537 5551 5571 5586 5659 5671
Synonym: AGM1; IMD23; PAGM; PGM 3
NM_001199918.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant 5, mRNA. (5956 bp)
gagtaaacaaacttatttctcattggcaaaaatgtgttgattgtaatggttcctattttaattaataaagatttgtgtgaacctagttataatgacttaaaattcatggtcccaaacagcaattacttttgcaccaaactaaaaatataagttaaaatggaagagtctaggagcaaaccaagaaaagatcacctacttcatcatctctggtcaaaaacaaaccaaaaaacttaacagctatcacttaagtttgcttcctagcaattatttagcttccagtctagattacaggatatataaaactttctttctttctttcttaactatgacactggcaccaatgagagtcctgtgactgactttcacatttccaccattactcaattactggtaccataccacctctaatcccctaaatcaaactgcaattcaacaataaagggcgtacagagatgactttgtcctgaaggaaaatgaatatccttgtaccctctatatagctaacttccaaatgtaagagaactatggggtaaccttttgtttctattcctatcaagatgagcctttaagagagggacttttattaagctcttgaccaag...
position 5368 5448 5501 5581 5598 5616 5630 5650 5665 5738 5750
Synonym: AGM1; IMD23; PAGM; PGM 3
NM_001367286.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant 2, mRNA. (6079 bp)
gagtaaacaaacttatttctcattggcaaaaatgtgttgattgtaatggttcctattttaattaataaagatttgtgtgaacctagttataatgacttaaaattcatggtcccaaacagcaattacttttgcaccaaactaaaaatataagttaaaatggaagagtctaggagcaaaccaagaaaagatcacctacttcatcatctctggtcaaaaacaaaccaaaaaacttaacagctatcacttaagtttgcttcctagcaattatttagcttccagtctagattacaggatatataaaactttctttctttctttcttaactatgacactggcaccaatgagagtcctgtgactgactttcacatttccaccattactcaattactggtaccataccacctctaatcccctaaatcaaactgcaattcaacaataaagggcgtacagagatgactttgtcctgaaggaaaatgaatatccttgtaccctctatatagctaacttccaaatgtaagagaactatggggtaaccttttgtttctattcctatcaagatgagcctttaagagagggacttttattaagctcttgaccaag...
position 5491 5571 5624 5704 5721 5739 5753 5773 5788 5861 5873
Synonym: AGM1; IMD23; PAGM; PGM 3
NM_015599.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant 1, mRNA. (6207 bp)
gagtaaacaaacttatttctcattggcaaaaatgtgttgattgtaatggttcctattttaattaataaagatttgtgtgaacctagttataatgacttaaaattcatggtcccaaacagcaattacttttgcaccaaactaaaaatataagttaaaatggaagagtctaggagcaaaccaagaaaagatcacctacttcatcatctctggtcaaaaacaaaccaaaaaacttaacagctatcacttaagtttgcttcctagcaattatttagcttccagtctagattacaggatatataaaactttctttctttctttcttaactatgacactggcaccaatgagagtcctgtgactgactttcacatttccaccattactcaattactggtaccataccacctctaatcccctaaatcaaactgcaattcaacaataaagggcgtacagagatgactttgtcctgaaggaaaatgaatatccttgtaccctctatatagctaacttccaaatgtaagagaactatggggtaaccttttgtttctattcctatcaagatgagcctttaagagagggacttttattaagctcttgaccaag...
position 5619 5699 5752 5832 5849 5867 5881 5901 5916 5989 6001
Synonym: AGM1; IMD23; PAGM; PGM 3
NM_001199917.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant 6, mRNA. (6216 bp)
gagtaaacaaacttatttctcattggcaaaaatgtgttgattgtaatggttcctattttaattaataaagatttgtgtgaacctagttataatgacttaaaattcatggtcccaaacagcaattacttttgcaccaaactaaaaatataagttaaaatggaagagtctaggagcaaaccaagaaaagatcacctacttcatcatctctggtcaaaaacaaaccaaaaaacttaacagctatcacttaagtttgcttcctagcaattatttagcttccagtctagattacaggatatataaaactttctttctttctttcttaactatgacactggcaccaatgagagtcctgtgactgactttcacatttccaccattactcaattactggtaccataccacctctaatcccctaaatcaaactgcaattcaacaataaagggcgtacagagatgactttgtcctgaaggaaaatgaatatccttgtaccctctatatagctaacttccaaatgtaagagaactatggggtaaccttttgtttctattcctatcaagatgagcctttaagagagggacttttattaagctcttgaccaag...
position 5628 5708 5761 5841 5858 5876 5890 5910 5925 5998 6010
Synonym: AGM1; IMD23; PAGM; PGM 3
NM_001367287.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/221788_at
lang : en | div : | spe : hs | query_string : 221788_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTAACTATGACACTGGCACCAA)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATGGTCCCAAACAGCAATTACTT)?source=Homo sapiens (human)?to=0&format=json
0.111 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACTGGTACCATACCACCTCTAATC)?source=Homo sapiens (human)?to=0&format=json
0.122 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGACTGACTTTCACATTTCCACCA)?source=Homo sapiens (human)?to=0&format=json
0.132 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACCCTCTATATAGCTAACTTCCA)?source=Homo sapiens (human)?to=0&format=json
0.142 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCACCAATGAGAGTCCTGTGACTG)?source=Homo sapiens (human)?to=0&format=json
0.153 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTATCACTTAAGTTTGCTTCCTAG)?source=Homo sapiens (human)?to=0&format=json
0.164 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATTTCCACCATTACTCAATTACTG)?source=Homo sapiens (human)?to=0&format=json
0.174 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGAATATCCTTGTACCCTCTATAT)?source=Homo sapiens (human)?to=0&format=json
0.184 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCTCTAATCCCCTAAATCAAACTG)?source=Homo sapiens (human)?to=0&format=json
0.194 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGATCACCTACTTCATCATCTCT)?source=Homo sapiens (human)?to=0&format=json
0.398 | 0.205 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTAACTATGACACTGGCACCAA)%26(nt:TCATGGTCCCAAACAGCAATTACTT)%26(nt:TACTGGTACCATACCACCTCTAATC)%26(nt:GTGACTGACTTTCACATTTCCACCA)%26(nt:GTACCCTCTATATAGCTAACTTCCA)%26(nt:GGCACCAATGAGAGTCCTGTGACTG)%26(nt:GCTATCACTTAAGTTTGCTTCCTAG)%26(nt:CATTTCCACCATTACTCAATTACTG)%26(nt:ATGAATATCCTTGTACCCTCTATAT)%26(nt:ACCTCTAATCCCCTAAATCAAACTG)%26(nt:AAAGATCACCTACTTCATCATCTCT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.403 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]