GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2020-08-14 20:39:34, GGRNA : RefSeq release 201 (Jul, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens membrane spanning 4-domains A12 (MS4A12), transcript variant 2, mRNA. (1044 bp)
atcttggccttcattggagtgattctgctgctggtggatatgtgcatcaatggggtagctggccaagactactgggccgtgctttctggaaaaggcatttcagccacgctgatgatcttctccctcttggagttcttcgtagcttgtgccacagcccattttgccaaccaagcaaacaccacaaccaatatgtctgtcctggttattccaaatatgtatgaaagcaaccctgtgacaccagcgtcttcttcagctcctcccagatgcaacaactactcagctaatgcccctaaatagtaaaagaaaaaggggtatcagtctaatctcatggagaaaaactacttgcaaaaacttcttaagaagatgtcttttattgtctacaatgatttctagtctttaaaaactgtgtttgagatttgtttttaggttggtcgctaatgatggctgtatctcccttcactgtctcttcctacattaccactactacatgctggcaaaggtgaaggatcagaggactgaaaaatgattctgcaactctcttaaagttagaaatgtttctgttcatattactttttccttaataaaatgtcattagaaaca...
position 484 520 550 601 616 642 682 697 856 892 946
Synonym: Ms4a10
NM_001164470.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens membrane spanning 4-domains A12 (MS4A12), transcript variant 1, mRNA. (1167 bp)
atcttggccttcattggagtgattctgctgctggtggatatgtgcatcaatggggtagctggccaagactactgggccgtgctttctggaaaaggcatttcagccacgctgatgatcttctccctcttggagttcttcgtagcttgtgccacagcccattttgccaaccaagcaaacaccacaaccaatatgtctgtcctggttattccaaatatgtatgaaagcaaccctgtgacaccagcgtcttcttcagctcctcccagatgcaacaactactcagctaatgcccctaaatagtaaaagaaaaaggggtatcagtctaatctcatggagaaaaactacttgcaaaaacttcttaagaagatgtcttttattgtctacaatgatttctagtctttaaaaactgtgtttgagatttgtttttaggttggtcgctaatgatggctgtatctcccttcactgtctcttcctacattaccactactacatgctggcaaaggtgaaggatcagaggactgaaaaatgattctgcaactctcttaaagttagaaatgtttctgttcatattactttttccttaataaaatgtcattagaaaca...
position 622 658 688 739 754 780 820 835 994 1030 1084
Synonym: Ms4a10
NM_017716.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens membrane spanning 4-domains A12 (MS4A12), transcript variant X1, mRNA. (1306 bp)
atcttggccttcattggagtgattctgctgctggtggatatgtgcatcaatggggtagctggccaagactactgggccgtgctttctggaaaaggcatttcagccacgctgatgatcttctccctcttggagttcttcgtagcttgtgccacagcccattttgccaaccaagcaaacaccacaaccaatatgtctgtcctggttattccaaatatgtatgaaagcaaccctgtgacaccagcgtcttcttcagctcctcccagatgcaacaactactcagctaatgcccctaaatagtaaaagaaaaaggggtatcagtctaatctcatggagaaaaactacttgcaaaaacttcttaagaagatgtcttttattgtctacaatgatttctagtctttaaaaactgtgtttgagatttgtttttaggttggtcgctaatgatggctgtatctcccttcactgtctcttcctacattaccactactacatgctggcaaaggtgaaggatcagaggactgaaaaatgattctgcaactctcttaaagttagaaatgtttctgttcatattactttttccttaataaaatgtcatta
position 770 806 836 887 902 928 968 983 1142 1178 1232
Synonym: Ms4a10
XM_011545117.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/220834_at
lang : en | div : | spe : hs | query_string : 220834_at | format : html | download :

0.000 | 0.000 | search_start;
0.082 | 0.082 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATGAAAGCAACCCTGTGACACCA)?source=Homo sapiens (human)?to=0&format=json
0.094 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCGCTAATGATGGCTGTATCTCC)?source=Homo sapiens (human)?to=0&format=json
0.102 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCATTTCAGCCACGCTGATGATCT)?source=Homo sapiens (human)?to=0&format=json
0.109 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGGCCAAGACTACTGGGCCGTGC)?source=Homo sapiens (human)?to=0&format=json
0.115 | 0.006 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCCTACATTACCACTACTACATG)?source=Homo sapiens (human)?to=0&format=json
0.127 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTTGGAGTTCTTCGTAGCTTGTG)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTCCCAGATGCAACAACTACTCAG)?source=Homo sapiens (human)?to=0&format=json
0.143 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGTCTGTCCTGGTTATTCCAAATA)?source=Homo sapiens (human)?to=0&format=json
0.418 | 0.275 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTACTCAGCTAATGCCCCTAAAT)?source=Homo sapiens (human)?to=0&format=json
0.427 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACACCACAACCAATATGTCTGTCC)?source=Homo sapiens (human)?to=0&format=json
0.438 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAATGATTCTGCAACTCTCTTAAA)?source=Homo sapiens (human)?to=0&format=json
0.490 | 0.052 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATGAAAGCAACCCTGTGACACCA)%26(nt:GGTCGCTAATGATGGCTGTATCTCC)%26(nt:GGCATTTCAGCCACGCTGATGATCT)%26(nt:GCTGGCCAAGACTACTGGGCCGTGC)%26(nt:CTTCCTACATTACCACTACTACATG)%26(nt:CTCTTGGAGTTCTTCGTAGCTTGTG)%26(nt:CCTCCCAGATGCAACAACTACTCAG)%26(nt:ATGTCTGTCCTGGTTATTCCAAATA)%26(nt:AACTACTCAGCTAATGCCCCTAAAT)%26(nt:AACACCACAACCAATATGTCTGTCC)%26(nt:AAAATGATTCTGCAACTCTCTTAAA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.492 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]