GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:40:49, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens zinc finger protein 556 (ZNF556), transcript variant 2, mRNA. (1643 bp)
caagcagtgtgggaaagcctactgctgggcaacatcctttcaacgacacgtgagaattcacaacggggagaaaccctataagtgtggaaaatgcgggaaagcattcggttggccctcatccttacacaaacacgcgagaacgcatgctaaaaagaaacctgtgagtgggggcagcgtgggaaagtcttccgcgaggcctcgcccctccacagatgtcaaatcacaaactagagagaaagtctataaatgtgaaacgtgtgggaaaacgtatggttggtcctcatctttacacaaacatgagagaaagcacactggggagaaacctgtaaatgcagccagtgtgggaaaaccttcaggcgggctttgctcttccaaaaatgtaagaacgcagattggacagaagcccagtaaatgcgaaaaatgtgggaaagctttcagttgtcccaaagcctttcaaggtcatgtgagaagtcacacaggaaagaaatcctgtacatctaagtaatgggggaaaacctgtgcaaattaattcacatacatggttcagaaaattcacagcaggagggccgggcgcagtggctcacgcctgtaatcccagca...
position 1043 1066 1101 1116 1123 1153 1215 1332 1384 1434 1453
NM_001300843.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger protein 556 (ZNF556), transcript variant 3, non-coding RNA. (6570 bp)
caagcagtgtgggaaagcctactgctgggcaacatcctttcaacgacacgtgagaattcacaacggggagaaaccctataagtgtggaaaatgcgggaaagcattcggttggccctcatccttacacaaacacgcgagaacgcatgctaaaaagaaacctgtgagtgggggcagcgtgggaaagtcttccgcgaggcctcgcccctccacagatgtcaaatcacaaactagagagaaagtctataaatgtgaaacgtgtgggaaaacgtatggttggtcctcatctttacacaaacatgagagaaagcacactggggagaaacctgtaaatgcagccagtgtgggaaaaccttcaggcgggctttgctcttccaaaaatgtaagaacgcagattggacagaagcccagtaaatgcgaaaaatgtgggaaagctttcagttgtcccaaagcctttcaaggtcatgtgagaagtcacacaggaaagaaatcctgtacatctaagtaatgggggaaaacctgtgcaaattaattcacatacatggttcagaaaattcacagcaggagggccgggcgcagtggctcacgcctgtaatcccagca...
position 1042 1065 1100 1115 1122 1152 1214 1331 1383 1433 1452
NR_145838.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger protein 556 (ZNF556), transcript variant 1, mRNA. (6574 bp)
caagcagtgtgggaaagcctactgctgggcaacatcctttcaacgacacgtgagaattcacaacggggagaaaccctataagtgtggaaaatgcgggaaagcattcggttggccctcatccttacacaaacacgcgagaacgcatgctaaaaagaaacctgtgagtgggggcagcgtgggaaagtcttccgcgaggcctcgcccctccacagatgtcaaatcacaaactagagagaaagtctataaatgtgaaacgtgtgggaaaacgtatggttggtcctcatctttacacaaacatgagagaaagcacactggggagaaacctgtaaatgcagccagtgtgggaaaaccttcaggcgggctttgctcttccaaaaatgtaagaacgcagattggacagaagcccagtaaatgcgaaaaatgtgggaaagctttcagttgtcccaaagcctttcaaggtcatgtgagaagtcacacaggaaagaaatcctgtacatctaagtaatgggggaaaacctgtgcaaattaattcacatacatggttcagaaaattcacagcaggagggccgggcgcagtggctcacgcctgtaatcccagca...
position 1046 1069 1104 1119 1126 1156 1218 1335 1387 1437 1456
NM_024967.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/220709_at
lang : en | div : | spe : hs | query_string : 220709_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAGTTGTCCCAAAGCCTTTCAAG)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.020 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGGGCAGCGTGGGAAAGTCTTCC)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.034 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATCCTTACACAAACACGCGAGAA)?source=Homo sapiens (human)?to=0&format=json
0.156 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAATGGGGGAAAACCTGTGCAAATT)?source=Homo sapiens (human)?to=0&format=json
0.167 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGGGAAAGCATTCGGTTGGCCCTC)?source=Homo sapiens (human)?to=0&format=json
0.194 | 0.027 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAATCCTGTACATCTAAGTAATGG)?source=Homo sapiens (human)?to=0&format=json
0.207 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCTCCACAGATGTCAAATCACAAA)?source=Homo sapiens (human)?to=0&format=json
0.217 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCGTGGGAAAGTCTTCCGCGAGGC)?source=Homo sapiens (human)?to=0&format=json
0.227 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGAACGCAGATTGGACAGAAGCCC)?source=Homo sapiens (human)?to=0&format=json
0.238 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACGTATGGTTGGTCCTCATCTTTA)?source=Homo sapiens (human)?to=0&format=json
0.248 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGAAACCTGTGAGTGGGGGCAGC)?source=Homo sapiens (human)?to=0&format=json
0.324 | 0.077 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAGTTGTCCCAAAGCCTTTCAAG)%26(nt:TGGGGGCAGCGTGGGAAAGTCTTCC)%26(nt:TCATCCTTACACAAACACGCGAGAA)%26(nt:TAATGGGGGAAAACCTGTGCAAATT)%26(nt:GCGGGAAAGCATTCGGTTGGCCCTC)%26(nt:GAAATCCTGTACATCTAAGTAATGG)%26(nt:CCCTCCACAGATGTCAAATCACAAA)%26(nt:AGCGTGGGAAAGTCTTCCGCGAGGC)%26(nt:AAGAACGCAGATTGGACAGAAGCCC)%26(nt:AACGTATGGTTGGTCCTCATCTTTA)%26(nt:AAAGAAACCTGTGAGTGGGGGCAGC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.326 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]