GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:59:55, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens semaphorin 4G (SEMA4G), transcript variant 2, mRNA. (3230 bp)
ctgagcctcccttgctgtcttggacctgtctgttgggtttagtccgtggacatttcagagggagatccccctcccatttaactgtcctcacaggcccttgcctaggatggatgaccaacactgcactcaatgagccagcctctcttttgggggaatcaagcatttgcttcctctagactacagcagggaaagggaggagaaatctgatgtctcaactggcacatgaagcccattcttggaactatgcaaagggcagaggctgggagtttggacgcttagctcctacccctgtcctacctcaccggggcactttcaggggccaggggcctctgaagtctctaggcctatatgggacaatcaattctgactgagctcccccattcccctcgggtgaggatgactgttatttttgtagctgagaacgtggaatcccacgggtttttactgcccttcacccaacctctcccacctccaccccacaatgaatgtatttattgtgagaatggctacacttctttaggaatgcccccacttacaaccaggtgggtggaacaggcatgtgacagagtggggagcctgggctcagctcctccccctgcc...
position 2657 2673 2699 2721 2746 2785 2803 2849 2940 3092 3109
NM_001203244.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens semaphorin 4G (SEMA4G), transcript variant X1, misc_RNA. (4345 bp)
ctgagcctcccttgctgtcttggacctgtctgttgggtttagtccgtggacatttcagagggagatccccctcccatttaactgtcctcacaggcccttgcctaggatggatgaccaacactgcactcaatgagccagcctctcttttgggggaatcaagcatttgcttcctctagactacagcagggaaagggaggagaaatctgatgtctcaactggcacatgaagcccattcttggaactatgcaaagggcagaggctgggagtttggacgcttagctcctacccctgtcctacctcaccggggcactttcaggggccaggggcctctgaagtctctaggcctatatgggacaatcaattctgactgagctcccccattcccctcgggtgaggatgactgttatttttgtagctgagaacgtggaatcccacgggtttttactgcccttcacccaacctctcccacctccaccccacaatgaatgtatttattgtgagaatggctacacttctttaggaatgcccccacttacaaccaggtgggtggaacaggcatgtgacagagtggggagcctgggctcagctcctccccctgcc...
position 3784 3800 3826 3848 3873 3912 3930 3976 4067 4219 4236
XR_246101.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens semaphorin 4G (SEMA4G), transcript variant 1, mRNA. (4415 bp)
ctgagcctcccttgctgtcttggacctgtctgttgggtttagtccgtggacatttcagagggagatccccctcccatttaactgtcctcacaggcccttgcctaggatggatgaccaacactgcactcaatgagccagcctctcttttgggggaatcaagcatttgcttcctctagactacagcagggaaagggaggagaaatctgatgtctcaactggcacatgaagcccattcttggaactatgcaaagggcagaggctgggagtttggacgcttagctcctacccctgtcctacctcaccggggcactttcaggggccaggggcctctgaagtctctaggcctatatgggacaatcaattctgactgagctcccccattcccctcgggtgaggatgactgttatttttgtagctgagaacgtggaatcccacgggtttttactgcccttcacccaacctctcccacctccaccccacaatgaatgtatttattgtgagaatggctacacttctttaggaatgcccccacttacaaccaggtgggtggaacaggcatgtgacagagtggggagcctgggctcagctcctccccctgcc...
position 3842 3858 3884 3906 3931 3970 3988 4034 4125 4277 4294
NM_017893.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens semaphorin 4G (SEMA4G), transcript variant X3, mRNA. (4462 bp)
ctgagcctcccttgctgtcttggacctgtctgttgggtttagtccgtggacatttcagagggagatccccctcccatttaactgtcctcacaggcccttgcctaggatggatgaccaacactgcactcaatgagccagcctctcttttgggggaatcaagcatttgcttcctctagactacagcagggaaagggaggagaaatctgatgtctcaactggcacatgaagcccattcttggaactatgcaaagggcagaggctgggagtttggacgcttagctcctacccctgtcctacctcaccggggcactttcaggggccaggggcctctgaagtctctaggcctatatgggacaatcaattctgactgagctcccccattcccctcgggtgaggatgactgttatttttgtagctgagaacgtggaatcccacgggtttttactgcccttcacccaacctctcccacctccaccccacaatgaatgtatttattgtgagaatggctacacttctttaggaatgcccccacttacaaccaggtgggtggaacaggcatgtgacagagtggggagcctgggctcagctcctccccctgcc...
position 3901 3917 3943 3965 3990 4029 4047 4093 4184 4336 4353
XM_024448091.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens semaphorin 4G (SEMA4G), transcript variant X4, misc_RNA. (4578 bp)
ctgagcctcccttgctgtcttggacctgtctgttgggtttagtccgtggacatttcagagggagatccccctcccatttaactgtcctcacaggcccttgcctaggatggatgaccaacactgcactcaatgagccagcctctcttttgggggaatcaagcatttgcttcctctagactacagcagggaaagggaggagaaatctgatgtctcaactggcacatgaagcccattcttggaactatgcaaagggcagaggctgggagtttggacgcttagctcctacccctgtcctacctcaccggggcactttcaggggccaggggcctctgaagtctctaggcctatatgggacaatcaattctgactgagctcccccattcccctcgggtgaggatgactgttatttttgtagctgagaacgtggaatcccacgggtttttactgcccttcacccaacctctcccacctccaccccacaatgaatgtatttattgtgagaatggctacacttctttaggaatgcccccacttacaaccaggtgggtggaacaggcatgtgacagagtggggagcctgggctcagctcctccccctgcc...
position 4017 4033 4059 4081 4106 4145 4163 4209 4300 4452 4469
XR_945792.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens semaphorin 4G (SEMA4G), transcript variant X2, mRNA. (4725 bp)
ctgagcctcccttgctgtcttggacctgtctgttgggtttagtccgtggacatttcagagggagatccccctcccatttaactgtcctcacaggcccttgcctaggatggatgaccaacactgcactcaatgagccagcctctcttttgggggaatcaagcatttgcttcctctagactacagcagggaaagggaggagaaatctgatgtctcaactggcacatgaagcccattcttggaactatgcaaagggcagaggctgggagtttggacgcttagctcctacccctgtcctacctcaccggggcactttcaggggccaggggcctctgaagtctctaggcctatatgggacaatcaattctgactgagctcccccattcccctcgggtgaggatgactgttatttttgtagctgagaacgtggaatcccacgggtttttactgcccttcacccaacctctcccacctccaccccacaatgaatgtatttattgtgagaatggctacacttctttaggaatgcccccacttacaaccaggtgggtggaacaggcatgtgacagagtggggagcctgggctcagctcctccccctgcc...
position 4164 4180 4206 4228 4253 4292 4310 4356 4447 4599 4616
XM_024448090.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/219194_at
lang : en | div : | spe : hs | query_string : 219194_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCACATGAAGCCCATTCTTGGAA)?source=Homo sapiens (human)?to=0&format=json
0.100 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGTTTGGACGCTTAGCTCCTACC)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTACACTTCTTTAGGAATGCCCCC)?source=Homo sapiens (human)?to=0&format=json
0.122 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCATTTGCTTCCTCTAGACTACAGC)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCAACACTGCACTCAATGAGCCA)?source=Homo sapiens (human)?to=0&format=json
0.154 | 0.021 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAATCTGATGTCTCAACTGGCACA)?source=Homo sapiens (human)?to=0&format=json
0.163 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCCCATTTAACTGTCCTCACAGGC)?source=Homo sapiens (human)?to=0&format=json
0.172 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCACAGGCCCTTGCCTAGGATGGA)?source=Homo sapiens (human)?to=0&format=json
0.182 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAGCCTCTCTTTTGGGGGAATCAA)?source=Homo sapiens (human)?to=0&format=json
0.264 | 0.081 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGCCCCCACTTACAACCAGGTGGG)?source=Homo sapiens (human)?to=0&format=json
0.275 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAATCAATTCTGACTGAGCTCCCC)?source=Homo sapiens (human)?to=0&format=json
0.421 | 0.146 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCACATGAAGCCCATTCTTGGAA)%26(nt:GGAGTTTGGACGCTTAGCTCCTACC)%26(nt:GCTACACTTCTTTAGGAATGCCCCC)%26(nt:GCATTTGCTTCCTCTAGACTACAGC)%26(nt:GACCAACACTGCACTCAATGAGCCA)%26(nt:GAAATCTGATGTCTCAACTGGCACA)%26(nt:CTCCCATTTAACTGTCCTCACAGGC)%26(nt:CTCACAGGCCCTTGCCTAGGATGGA)%26(nt:CCAGCCTCTCTTTTGGGGGAATCAA)%26(nt:ATGCCCCCACTTACAACCAGGTGGG)%26(nt:ACAATCAATTCTGACTGAGCTCCCC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.424 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]