GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:21:27, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens DEAH-box helicase 40 (DHX40), transcript variant 2, mRNA. (3344 bp)
caaattcctttttatataaaagtatattgtttaaaacagtagctatagccattaaccaaaggacagatgatatatatatatatgatatatatatatatataagttcttttttagctgtacctacgtacttatatcagcaccatgtatgtaggtgtgatagtactttcaaacagcgcctccacctggcctactctgttatttccacctgtttgggtagggccatttaacttccattatgccaaacttgggatgggattttcgaagcagacaacactatttcatcgtgtttcaaattggaaccttgaggctagttagtatcacactcaggccacactcagcacttgcccactcttgtttactgccttgtattctagttatttgtgtatttgtctccctcactagattatacgctccttgtgggcagggactgtgtcttttttcatctttgtatctttcatgcacctagcatagtgctttgcacatagtagtcactcagtgtttgttaaataaagctattagtgtcattaaaattcaaaa
position 2912 2927 2962 3007 3023 3054 3068 3113 3158 3207 3280
Synonym: ARG147; DDX40; PAD
NM_001166301.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens DEAH-box helicase 40 (DHX40), transcript variant X3, mRNA. (3408 bp)
caaattcctttttatataaaagtatattgtttaaaacagtagctatagccattaaccaaaggacagatgatatatatatatatgatatatatatatatataagttcttttttagctgtacctacgtacttatatcagcaccatgtatgtaggtgtgatagtactttcaaacagcgcctccacctggcctactctgttatttccacctgtttgggtagggccatttaacttccattatgccaaacttgggatgggattttcgaagcagacaacactatttcatcgtgtttcaaattggaaccttgaggctagttagtatcacactcaggccacactcagcacttgcccactcttgtttactgccttgtattctagttatttgtgtatttgtctccctcactagattatacgctccttgtgggcagggactgtgtcttttttcatctttgtatctttcatgcacctagcatagtgctttgcacatagtagtcactcagtgtttgttaaataaagctattagtgtcattaaaattcaaaa
position 2976 2991 3026 3071 3087 3118 3132 3177 3222 3271 3344
Synonym: ARG147; DDX40; PAD
XM_011525253.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens DEAH-box helicase 40 (DHX40), transcript variant 1, mRNA. (3575 bp)
caaattcctttttatataaaagtatattgtttaaaacagtagctatagccattaaccaaaggacagatgatatatatatatatgatatatatatatatataagttcttttttagctgtacctacgtacttatatcagcaccatgtatgtaggtgtgatagtactttcaaacagcgcctccacctggcctactctgttatttccacctgtttgggtagggccatttaacttccattatgccaaacttgggatgggattttcgaagcagacaacactatttcatcgtgtttcaaattggaaccttgaggctagttagtatcacactcaggccacactcagcacttgcccactcttgtttactgccttgtattctagttatttgtgtatttgtctccctcactagattatacgctccttgtgggcagggactgtgtcttttttcatctttgtatctttcatgcacctagcatagtgctttgcacatagtagtcactcagtgtttgttaaataaagctattagtgtcattaaaattcaaaa
position 3143 3158 3193 3238 3254 3285 3299 3344 3389 3438 3511
Synonym: ARG147; DDX40; PAD
NM_024612.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/218277_s_at
lang : en | div : | spe : hs | query_string : 218277_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCACCTGTTTGGGTAGGGCCATT)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGATAGTACTTTCAAACAGCGCCTC)?source=Homo sapiens (human)?to=0&format=json
0.111 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTTTTTAGCTGTACCTACGTACT)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAGATTATACGCTCCTTGTGGGCAG)?source=Homo sapiens (human)?to=0&format=json
0.136 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGATGGGATTTTCGAAGCAGACAA)?source=Homo sapiens (human)?to=0&format=json
0.147 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTAGTTAGTATCACACTCAGGCC)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTTTGCACATAGTAGTCACTCAGT)?source=Homo sapiens (human)?to=0&format=json
0.165 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAGCAGACAACACTATTTCATCGT)?source=Homo sapiens (human)?to=0&format=json
0.175 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTGTTTACTGCCTTGTATTCTAGT)?source=Homo sapiens (human)?to=0&format=json
0.188 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTACGTACTTATATCAGCACCATG)?source=Homo sapiens (human)?to=0&format=json
0.198 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGGCCATTTAACTTCCATTATGCC)?source=Homo sapiens (human)?to=0&format=json
0.265 | 0.068 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCACCTGTTTGGGTAGGGCCATT)%26(nt:TGATAGTACTTTCAAACAGCGCCTC)%26(nt:TCTTTTTTAGCTGTACCTACGTACT)%26(nt:TAGATTATACGCTCCTTGTGGGCAG)%26(nt:GGGATGGGATTTTCGAAGCAGACAA)%26(nt:GGCTAGTTAGTATCACACTCAGGCC)%26(nt:GCTTTGCACATAGTAGTCACTCAGT)%26(nt:GAAGCAGACAACACTATTTCATCGT)%26(nt:CTTGTTTACTGCCTTGTATTCTAGT)%26(nt:CCTACGTACTTATATCAGCACCATG)%26(nt:AGGGCCATTTAACTTCCATTATGCC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.268 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]