GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:24:53, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ArfGAP with FG repeats 1 (AGFG1), transcript variant 4, mRNA. (8557 bp)
ttttaaaaagctttggtattaaaagaggtaaacatcagtttcctcaaacattttattcatgttgaatgcctttttgcaatgatgactgagttgttatcatagtattttaaaacctgtatagtgttttagacttgttaaaacattgctgtctagtgtacatctagctaaaagtgtggtttatctaaaccgttttaataagcaagatgactgggaaatctctgccccttttctgagcagtatgcctcttcttttagaattaaatgaatgctgcacaggtccagatgtgtgttgatgtagacttgaaatgtctccacattttggaggacttcctcagcccttttcattgagggaaaatatatttgaatttctgttttagattgtatcgggtcccagttgattcatgtgtacaaagttatgctacctaattacagaccattacccaaatatcctaccaggctttccatctgaatagtaaattaaacagttgttatcaaaatgattttaaagactatttctttttctgggtaactattgaagtttgtaattaaatgggggctcttactgactttaaattagcgcttataaaataaaaatgtttag...
position 3648 3711 3726 3737 3772 3835 3879 3894 3920 3938 3948
Synonym: HRB; RAB; RIP
NM_001135189.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ArfGAP with FG repeats 1 (AGFG1), transcript variant 3, mRNA. (8671 bp)
ttttaaaaagctttggtattaaaagaggtaaacatcagtttcctcaaacattttattcatgttgaatgcctttttgcaatgatgactgagttgttatcatagtattttaaaacctgtatagtgttttagacttgttaaaacattgctgtctagtgtacatctagctaaaagtgtggtttatctaaaccgttttaataagcaagatgactgggaaatctctgccccttttctgagcagtatgcctcttcttttagaattaaatgaatgctgcacaggtccagatgtgtgttgatgtagacttgaaatgtctccacattttggaggacttcctcagcccttttcattgagggaaaatatatttgaatttctgttttagattgtatcgggtcccagttgattcatgtgtacaaagttatgctacctaattacagaccattacccaaatatcctaccaggctttccatctgaatagtaaattaaacagttgttatcaaaatgattttaaagactatttctttttctgggtaactattgaagtttgtaattaaatgggggctcttactgactttaaattagcgcttataaaataaaaatgtttag...
position 3762 3825 3840 3851 3886 3949 3993 4008 4034 4052 4062
Synonym: HRB; RAB; RIP
NM_001135188.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ArfGAP with FG repeats 1 (AGFG1), transcript variant 2, mRNA. (8677 bp)
ttttaaaaagctttggtattaaaagaggtaaacatcagtttcctcaaacattttattcatgttgaatgcctttttgcaatgatgactgagttgttatcatagtattttaaaacctgtatagtgttttagacttgttaaaacattgctgtctagtgtacatctagctaaaagtgtggtttatctaaaccgttttaataagcaagatgactgggaaatctctgccccttttctgagcagtatgcctcttcttttagaattaaatgaatgctgcacaggtccagatgtgtgttgatgtagacttgaaatgtctccacattttggaggacttcctcagcccttttcattgagggaaaatatatttgaatttctgttttagattgtatcgggtcccagttgattcatgtgtacaaagttatgctacctaattacagaccattacccaaatatcctaccaggctttccatctgaatagtaaattaaacagttgttatcaaaatgattttaaagactatttctttttctgggtaactattgaagtttgtaattaaatgggggctcttactgactttaaattagcgcttataaaataaaaatgtttag...
position 3768 3831 3846 3857 3892 3955 3999 4014 4040 4058 4068
Synonym: HRB; RAB; RIP
NM_004504.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ArfGAP with FG repeats 1 (AGFG1), transcript variant 1, mRNA. (8743 bp)
ttttaaaaagctttggtattaaaagaggtaaacatcagtttcctcaaacattttattcatgttgaatgcctttttgcaatgatgactgagttgttatcatagtattttaaaacctgtatagtgttttagacttgttaaaacattgctgtctagtgtacatctagctaaaagtgtggtttatctaaaccgttttaataagcaagatgactgggaaatctctgccccttttctgagcagtatgcctcttcttttagaattaaatgaatgctgcacaggtccagatgtgtgttgatgtagacttgaaatgtctccacattttggaggacttcctcagcccttttcattgagggaaaatatatttgaatttctgttttagattgtatcgggtcccagttgattcatgtgtacaaagttatgctacctaattacagaccattacccaaatatcctaccaggctttccatctgaatagtaaattaaacagttgttatcaaaatgattttaaagactatttctttttctgggtaactattgaagtttgtaattaaatgggggctcttactgactttaaattagcgcttataaaataaaaatgtttag...
position 3834 3897 3912 3923 3958 4021 4065 4080 4106 4124 4134
Synonym: HRB; RAB; RIP
NM_001135187.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/218091_at
lang : en | div : | spe : hs | query_string : 218091_at | format : html | download :

0.000 | 0.000 | search_start;
0.088 | 0.088 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTGAGCAGTATGCCTCTTCTTTT)?source=Homo sapiens (human)?to=0&format=json
0.099 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTTAGATTGTATCGGGTCCCAGT)?source=Homo sapiens (human)?to=0&format=json
0.113 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGTCCCAGTTGATTCATGTGTACA)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATGCTGCACAGGTCCAGATGTGT)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCCTCAGCCCTTTTCATTGAGGG)?source=Homo sapiens (human)?to=0&format=json
0.146 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGCCCCTTTTCTGAGCAGTATG)?source=Homo sapiens (human)?to=0&format=json
0.156 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAAATATCCTACCAGGCTTTCCA)?source=Homo sapiens (human)?to=0&format=json
0.166 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGACCATTACCCAAATATCCTACC)?source=Homo sapiens (human)?to=0&format=json
0.175 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTTATGCTACCTAATTACAGACCA)?source=Homo sapiens (human)?to=0&format=json
0.186 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATGACTGGGAAATCTCTGCCCCT)?source=Homo sapiens (human)?to=0&format=json
0.197 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACATTGCTGTCTAGTGTACATCTA)?source=Homo sapiens (human)?to=0&format=json
0.250 | 0.053 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTGAGCAGTATGCCTCTTCTTTT)%26(nt:GTTTTAGATTGTATCGGGTCCCAGT)%26(nt:GGGTCCCAGTTGATTCATGTGTACA)%26(nt:GAATGCTGCACAGGTCCAGATGTGT)%26(nt:CTTCCTCAGCCCTTTTCATTGAGGG)%26(nt:CTCTGCCCCTTTTCTGAGCAGTATG)%26(nt:CCCAAATATCCTACCAGGCTTTCCA)%26(nt:CAGACCATTACCCAAATATCCTACC)%26(nt:AGTTATGCTACCTAATTACAGACCA)%26(nt:AGATGACTGGGAAATCTCTGCCCCT)%26(nt:AACATTGCTGTCTAGTGTACATCTA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.252 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]