GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-10-17 16:20:00, GGRNA : RefSeq release 207 (Jul, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens sorting nexin 5 (SNX5), transcript variant 3, mRNA. (2016 bp)
atttaaccatgttggtttaaaaatattattgcttgctacttggacataactaatttttccttgtgcatttaatacctctgggcagaatccaaatactgggttctcccgtagttcgtctttagttactaagaaagggtgtaggacacattagccttctggaaacaagtagaagccatcacctggcccatgtccctacaaacccatgattgtcagggaggtgccagttacagcaggtgattcagctacttgaggtcggtaacagaccttccattcctcactgaaggtggggtttgtgtttttgttttgccctgttactccactggtagtcatctggtgtttgtactataacaacagcaagaaaatctcatttatctttatatactctttgcacctcctttttttagtcgagatataaatatttgaggggagagaaatatctacaggtatatatggaaacaaataatgtggtctgctttataagatggccagatctacattaggaaaagtataagccccctccctaatggccgctggggggtgagggcggtgtgttgtatgtctttgggtgtttgtttttttataaagcatataataaaataa...
position 1463 1489 1538 1568 1591 1637 1655 1711 1791 1922 1942
NM_001282454.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sorting nexin 5 (SNX5), transcript variant 1, mRNA. (2099 bp)
atttaaccatgttggtttaaaaatattattgcttgctacttggacataactaatttttccttgtgcatttaatacctctgggcagaatccaaatactgggttctcccgtagttcgtctttagttactaagaaagggtgtaggacacattagccttctggaaacaagtagaagccatcacctggcccatgtccctacaaacccatgattgtcagggaggtgccagttacagcaggtgattcagctacttgaggtcggtaacagaccttccattcctcactgaaggtggggtttgtgtttttgttttgccctgttactccactggtagtcatctggtgtttgtactataacaacagcaagaaaatctcatttatctttatatactctttgcacctcctttttttagtcgagatataaatatttgaggggagagaaatatctacaggtatatatggaaacaaataatgtggtctgctttataagatggccagatctacattaggaaaagtataagccccctccctaatggccgctggggggtgagggcggtgtgttgtatgtctttgggtgtttgtttttttataaagcatataataaaataa...
position 1546 1572 1621 1651 1674 1720 1738 1794 1874 2005 2025
NM_152227.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sorting nexin 5 (SNX5), transcript variant 2, mRNA. (2341 bp)
atttaaccatgttggtttaaaaatattattgcttgctacttggacataactaatttttccttgtgcatttaatacctctgggcagaatccaaatactgggttctcccgtagttcgtctttagttactaagaaagggtgtaggacacattagccttctggaaacaagtagaagccatcacctggcccatgtccctacaaacccatgattgtcagggaggtgccagttacagcaggtgattcagctacttgaggtcggtaacagaccttccattcctcactgaaggtggggtttgtgtttttgttttgccctgttactccactggtagtcatctggtgtttgtactataacaacagcaagaaaatctcatttatctttatatactctttgcacctcctttttttagtcgagatataaatatttgaggggagagaaatatctacaggtatatatggaaacaaataatgtggtctgctttataagatggccagatctacattaggaaaagtataagccccctccctaatggccgctggggggtgagggcggtgtgttgtatgtctttgggtgtttgtttttttataaagcatataataaaataa...
position 1788 1814 1863 1893 1916 1962 1980 2036 2116 2247 2267
NM_014426.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/217792_at
lang : en | div : | spe : hs | query_string : 217792_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCACCTCCTTTTTTTAGTCGAGAT)?source=Homo sapiens (human)?to=0&format=json
0.096 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCCTAATGGCCGCTGGGGGGTGAG)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGAGGGCGGTGTGTTGTATGTCTT)?source=Homo sapiens (human)?to=0&format=json
0.283 | 0.180 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGATTCAGCTACTTGAGGTCGGT)?source=Homo sapiens (human)?to=0&format=json
0.955 | 0.672 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCGGTAACAGACCTTCCATTCCT)?source=Homo sapiens (human)?to=0&format=json
0.964 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGTGTAGGACACATTAGCCTTCTG)?source=Homo sapiens (human)?to=0&format=json
0.971 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATCCAAATACTGGGTTCTCCCGT)?source=Homo sapiens (human)?to=0&format=json
0.978 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTTGTGCATTTAATACCTCTGGGC)?source=Homo sapiens (human)?to=0&format=json
0.985 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCTGTTACTCCACTGGTAGTCATC)?source=Homo sapiens (human)?to=0&format=json
0.994 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGTCCCTACAAACCCATGATTGTC)?source=Homo sapiens (human)?to=0&format=json
1.001 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTAGAAGCCATCACCTGGCCCAT)?source=Homo sapiens (human)?to=0&format=json
1.066 | 0.065 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCACCTCCTTTTTTTAGTCGAGAT)%26(nt:TCCCTAATGGCCGCTGGGGGGTGAG)%26(nt:GTGAGGGCGGTGTGTTGTATGTCTT)%26(nt:GGTGATTCAGCTACTTGAGGTCGGT)%26(nt:GGTCGGTAACAGACCTTCCATTCCT)%26(nt:GGGTGTAGGACACATTAGCCTTCTG)%26(nt:GAATCCAAATACTGGGTTCTCCCGT)%26(nt:CCTTGTGCATTTAATACCTCTGGGC)%26(nt:CCCTGTTACTCCACTGGTAGTCATC)%26(nt:ATGTCCCTACAAACCCATGATTGTC)%26(nt:AAGTAGAAGCCATCACCTGGCCCAT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
1.068 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]