GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:26:03, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens integral membrane protein 2B (ITM2B), mRNA. (10089 bp)
gaagttgaatttatcagtgtgcctgtcccagagtttgcagatagtgatcctgccaacattgttcatgactttaacaagaaacttacagcctatttagatcttaacctggataagtgctatgtgatccctctgaacacttccattgttatgccacccagaaacctactggagttacttattaacatcaaggctggaacctatttgcctcagtcctatctgattcatgagcacatggttattactgatcgcattgaaaacattgatcacctgggtttctttatttatcgactgtgtcatgacaaggaaacttacaaactgcaacgcagagaaactattaaaggtattcagaaacgtgaagccagcaattgtttcgcaattcggcattttgaaaacaaatttgccgtggaaactttaatttgttcttgaacagtcaagaaaaacattattgaggaaaattaatatcacagcataaccccaccctttacattttgtgcagtgattattttttaaagtcttctttcatgtaagtagcaaacagggctttactatcttttcatctcattaattcaattaaaaccattaccttaaaatttttttctt...
position 576 641 661 717 732 783 800 833 895 1061 1075
Synonym: ABRI; BRI; BRI2; BRICD2B; E25B; E3-16; FBD; imBRI2; RDGCA
NM_021999.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/217732_s_at
lang : en | div : | spe : hs | query_string : 217732_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCCTCAGTCCTATCTGATTCATG)?source=Homo sapiens (human)?to=0&format=json
0.100 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAACACTTCCATTGTTATGCCACC)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAGTGCTATGTGATCCCTCTGAAC)?source=Homo sapiens (human)?to=0&format=json
0.121 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGTTTCTTTATTTATCGACTGTGT)?source=Homo sapiens (human)?to=0&format=json
0.132 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAAACTTACAAACTGCAACGCAGA)?source=Homo sapiens (human)?to=0&format=json
0.142 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAAACAGGGCTTTACTATCTTTTC)?source=Homo sapiens (human)?to=0&format=json
0.154 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCCTGCCAACATTGTTCATGACT)?source=Homo sapiens (human)?to=0&format=json
0.165 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAAACATTGATCACCTGGGTTTCT)?source=Homo sapiens (human)?to=0&format=json
0.175 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTGTTTCGCAATTCGGCATTTTGA)?source=Homo sapiens (human)?to=0&format=json
0.185 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTATCTTTTCATCTCATTAATTCA)?source=Homo sapiens (human)?to=0&format=json
0.196 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGGCTGGAACCTATTTGCCTCAGT)?source=Homo sapiens (human)?to=0&format=json
0.254 | 0.058 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCCTCAGTCCTATCTGATTCATG)%26(nt:TGAACACTTCCATTGTTATGCCACC)%26(nt:TAAGTGCTATGTGATCCCTCTGAAC)%26(nt:GGGTTTCTTTATTTATCGACTGTGT)%26(nt:GGAAACTTACAAACTGCAACGCAGA)%26(nt:GCAAACAGGGCTTTACTATCTTTTC)%26(nt:GATCCTGCCAACATTGTTCATGACT)%26(nt:GAAAACATTGATCACCTGGGTTTCT)%26(nt:ATTGTTTCGCAATTCGGCATTTTGA)%26(nt:ACTATCTTTTCATCTCATTAATTCA)%26(nt:AAGGCTGGAACCTATTTGCCTCAGT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.255 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]