GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:11:52, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens eukaryotic translation initiation factor 3 subunit L (EIF3L), transcript variant 2, mRNA. (2525 bp)
gcccagctttcaaccatccgcagcttcctgaagctctacaccaccatgcctgtggccaagctggctggcttcctggacctcacagagcaggagttccggatccagcttcttgtcttcaaacacaagatgaagaacctcgtgtggaccagcggtatctcagccctggatggtgaatttcagtcagcctcagaggttgacttctacattgataaggacatgatccacatcgcggacaccaaggtcgccaggcgttatggggatttcttcatccgtcagatccacaaatttgaggagcttaatcgaaccctgaagaagatgggacagagaccttgatgatattcacacacattcaggaacctgttttgatgtattataggcaggaagtgtttttgctaccgtgaaacctttacctagatcagccatcagcctgtcaactcagttaacaagttaaggaccgaagtgtttcaagtggatctcagtaaaggatctttggagccagatttgtcgtctcattattgtaggagagaatttgtgggttgtggcagtaatacatttcccatgtgtcctgatgctttcaggatacatcagttgttagtgttt...
position 1374 1489 1499 1518 1573 1587 1625 1639 1654 1669 1701
Synonym: EIF3EIP; EIF3S11; EIF3S6IP; HSPC021; HSPC025; MSTP005
NM_001242923.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens eukaryotic translation initiation factor 3 subunit L (EIF3L), transcript variant 3, mRNA. (2589 bp)
gcccagctttcaaccatccgcagcttcctgaagctctacaccaccatgcctgtggccaagctggctggcttcctggacctcacagagcaggagttccggatccagcttcttgtcttcaaacacaagatgaagaacctcgtgtggaccagcggtatctcagccctggatggtgaatttcagtcagcctcagaggttgacttctacattgataaggacatgatccacatcgcggacaccaaggtcgccaggcgttatggggatttcttcatccgtcagatccacaaatttgaggagcttaatcgaaccctgaagaagatgggacagagaccttgatgatattcacacacattcaggaacctgttttgatgtattataggcaggaagtgtttttgctaccgtgaaacctttacctagatcagccatcagcctgtcaactcagttaacaagttaaggaccgaagtgtttcaagtggatctcagtaaaggatctttggagccagatttgtcgtctcattattgtaggagagaatttgtgggttgtggcagtaatacatttcccatgtgtcctgatgctttcaggatacatcagttgttagtgttt...
position 1438 1553 1563 1582 1637 1651 1689 1703 1718 1733 1765
Synonym: EIF3EIP; EIF3S11; EIF3S6IP; HSPC021; HSPC025; MSTP005
NM_001363785.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens eukaryotic translation initiation factor 3 subunit L (EIF3L), transcript variant 1, mRNA. (2669 bp)
gcccagctttcaaccatccgcagcttcctgaagctctacaccaccatgcctgtggccaagctggctggcttcctggacctcacagagcaggagttccggatccagcttcttgtcttcaaacacaagatgaagaacctcgtgtggaccagcggtatctcagccctggatggtgaatttcagtcagcctcagaggttgacttctacattgataaggacatgatccacatcgcggacaccaaggtcgccaggcgttatggggatttcttcatccgtcagatccacaaatttgaggagcttaatcgaaccctgaagaagatgggacagagaccttgatgatattcacacacattcaggaacctgttttgatgtattataggcaggaagtgtttttgctaccgtgaaacctttacctagatcagccatcagcctgtcaactcagttaacaagttaaggaccgaagtgtttcaagtggatctcagtaaaggatctttggagccagatttgtcgtctcattattgtaggagagaatttgtgggttgtggcagtaatacatttcccatgtgtcctgatgctttcaggatacatcagttgttagtgttt...
position 1518 1633 1643 1662 1717 1731 1769 1783 1798 1813 1845
Synonym: EIF3EIP; EIF3S11; EIF3S6IP; HSPC021; HSPC025; MSTP005
NM_016091.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/217719_at
lang : en | div : | spe : hs | query_string : 217719_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCTACCGTGAAACCTTTACCTAG)?source=Homo sapiens (human)?to=0&format=json
0.099 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCGTCAGATCCACAAATTTGAGGA)?source=Homo sapiens (human)?to=0&format=json
0.109 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCGCCAGGCGTTATGGGGATTTC)?source=Homo sapiens (human)?to=0&format=json
0.118 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCAGGAAGTGTTTTTGCTACCGTG)?source=Homo sapiens (human)?to=0&format=json
0.128 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACCGAAGTGTTTCAAGTGGATCT)?source=Homo sapiens (human)?to=0&format=json
0.138 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACCTTGATGATATTCACACACA)?source=Homo sapiens (human)?to=0&format=json
0.150 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTTACCTAGATCAGCCATCAGCCT)?source=Homo sapiens (human)?to=0&format=json
0.161 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTTATGGGGATTTCTTCATCCGTC)?source=Homo sapiens (human)?to=0&format=json
0.172 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCATCAGCCTGTCAACTCAGTTAAC)?source=Homo sapiens (human)?to=0&format=json
0.182 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTCACACACATTCAGGAACCTGTT)?source=Homo sapiens (human)?to=0&format=json
0.191 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATGAAGAACCTCGTGTGGACCAG)?source=Homo sapiens (human)?to=0&format=json
0.259 | 0.068 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCTACCGTGAAACCTTTACCTAG)%26(nt:TCCGTCAGATCCACAAATTTGAGGA)%26(nt:GGTCGCCAGGCGTTATGGGGATTTC)%26(nt:GGCAGGAAGTGTTTTTGCTACCGTG)%26(nt:GGACCGAAGTGTTTCAAGTGGATCT)%26(nt:GAGACCTTGATGATATTCACACACA)%26(nt:CTTTACCTAGATCAGCCATCAGCCT)%26(nt:CGTTATGGGGATTTCTTCATCCGTC)%26(nt:CCATCAGCCTGTCAACTCAGTTAAC)%26(nt:ATTCACACACATTCAGGAACCTGTT)%26(nt:AGATGAAGAACCTCGTGTGGACCAG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.261 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]