GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:16:31, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X9, mRNA. (1048 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 409 440 456 479 516 626 696 730 791 964 993
Synonym: GGT; GGT 2
XM_006724396.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X10, mRNA. (1058 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 419 450 466 489 526 636 706 740 801 974 1003
Synonym: GGT; GGT 2
XM_017029184.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X8, mRNA. (1486 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 847 878 894 917 954 1064 1134 1168 1229 1402 1431
Synonym: GGT; GGT 2
XM_017029183.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X7, mRNA. (1510 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 871 902 918 941 978 1088 1158 1192 1253 1426 1455
Synonym: GGT; GGT 2
XM_005261890.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X6, mRNA. (1621 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 982 1013 1029 1052 1089 1199 1269 1303 1364 1537 1566
Synonym: GGT; GGT 2
XM_006724395.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X2, mRNA. (2218 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 1579 1610 1626 1649 1686 1796 1866 1900 1961 2134 2163
Synonym: GGT; GGT 2
XM_006724392.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X3, mRNA. (2357 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 1718 1749 1765 1788 1825 1935 2005 2039 2100 2273 2302
Synonym: GGT; GGT 2
XM_017029180.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens gamma-glutamyltransferase 2 (GGT2), mRNA. (2583 bp)
gcattcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgcacggctggtggctgggcagctgcctcggactccaggaaaggcggggaacctgctggctactgattgctccaggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccact
position 2026 2057 2073 2096 2133 2162 2232 2266 2327 2500 2529
Synonym: GGT; GGT 2
NM_001351304.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X4, mRNA. (2836 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 2197 2228 2244 2267 2304 2414 2484 2518 2579 2752 2781
Synonym: GGT; GGT 2
XM_017029181.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X1, mRNA. (2940 bp)
attcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgccc...ggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgca...ggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 2301 2332 2348 2371 2408 2518 2588 2622 2683 2856 2885
Synonym: GGT; GGT 2
XM_017029179.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X13, mRNA. (3322 bp)
gcattcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcctgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgcacggctggtggctgggcagctgcctcggactccaggaaaggcggggaacctgctggctactgattgctccaggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctccccactc
position 2764 2795 2811 2834 2871 2900 2970 3004 3065 3238 3267
Synonym: GGT; GGT 2
XM_017029186.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/215603_x_at
lang : en | div : | spe : hs | query_string : 215603_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.088 | 0.088 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTGTCCATGTGCCTGACGATCAT)?source=Homo sapiens (human)?to=0&format=json
0.098 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCCCAACGTCACGACAGTGGAG)?source=Homo sapiens (human)?to=0&format=json
0.108 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATCTACAACCTCTGGTTCGGCTA)?source=Homo sapiens (human)?to=0&format=json
0.120 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATCGCTGTGGTGCAAGCCATCGT)?source=Homo sapiens (human)?to=0&format=json
0.131 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAATGAGGCCACTGTGCCAGGCTC)?source=Homo sapiens (human)?to=0&format=json
0.144 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCAGGTCCGGATGGTGGTGGGAGC)?source=Homo sapiens (human)?to=0&format=json
0.157 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCAATTTCATCCAGCCAGGGAAGC)?source=Homo sapiens (human)?to=0&format=json
0.168 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGATCACCACAGACACTGCACTG)?source=Homo sapiens (human)?to=0&format=json
0.178 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACGATCATGGTGGGCCAGGACGGC)?source=Homo sapiens (human)?to=0&format=json
0.188 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCAGGCAGTGACTGCAGCCCTGG)?source=Homo sapiens (human)?to=0&format=json
0.199 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCCCCTGTGAGCAGCAGAGCAGC)?source=Homo sapiens (human)?to=0&format=json
0.417 | 0.218 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTGTCCATGTGCCTGACGATCAT)%26(nt:TCTGCCCAACGTCACGACAGTGGAG)%26(nt:TCATCTACAACCTCTGGTTCGGCTA)%26(nt:TCATCGCTGTGGTGCAAGCCATCGT)%26(nt:TAAATGAGGCCACTGTGCCAGGCTC)%26(nt:GCCAGGTCCGGATGGTGGTGGGAGC)%26(nt:GCCAATTTCATCCAGCCAGGGAAGC)%26(nt:GCAGATCACCACAGACACTGCACTG)%26(nt:GACGATCATGGTGGGCCAGGACGGC)%26(nt:GACCAGGCAGTGACTGCAGCCCTGG)%26(nt:CTTCCCCTGTGAGCAGCAGAGCAGC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.424 | 0.007 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]