GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:43:47, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens fasciculation and elongation protein zeta 2 (FEZ2), transcript variant X2, mRNA. (1936 bp)
aactgacagtatgcccatttgtttttatggctttcttatctaaactgcactgatgaactagattaaagccttgggagatttatactataaattcagtgatggcaagaaccaacactgtttttttgtgagaattgtcagtgtaactattacctaccagtattgttcagagagattgaaacagaataaacgggctgttcttgaagaagcaaaaccagaatatgcattactttggtttaatacttagtgctaacattgaaactgttggtggtgatggattttgtagcttgctgcttgtttcaccactggtcaaattttaaccattaaattgccattcacttttagaatcttgtatttaagttttgattttcaaatgttctgcttcatgtgtctgtgaagaattgtactttaagtgtgtgtcctctgaggtgcttgagaaagtgtacactgcagaactgcccattctcattactgtgtcctattttattcatgcctgtgtgtttttcttaagtatgaattctagatacagctacttatggattcatcaatatcatgagcacttttgctggttccagtcaaatcaatggcatttaataaattttt...
position 1333 1444 1582 1592 1620 1712 1744 1761 1773 1784 1852
Synonym: HUM3CL
XM_006712153.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens fasciculation and elongation protein zeta 2 (FEZ2), transcript variant X1, misc_RNA. (1958 bp)
aactgacagtatgcccatttgtttttatggctttcttatctaaactgcactgatgaactagattaaagccttgggagatttatactataaattcagtgatggcaagaaccaacactgtttttttgtgagaattgtcagtgtaactattacctaccagtattgttcagagagattgaaacagaataaacgggctgttcttgaagaagcaaaaccagaatatgcattactttggtttaatacttagtgctaacattgaaactgttggtggtgatggattttgtagcttgctgcttgtttcaccactggtcaaattttaaccattaaattgccattcacttttagaatcttgtatttaagttttgattttcaaatgttctgcttcatgtgtctgtgaagaattgtactttaagtgtgtgtcctctgaggtgcttgagaaagtgtacactgcagaactgcccattctcattactgtgtcctattttattcatgcctgtgtgtttttcttaagtatgaattctagatacagctacttatggattcatcaatatcatgagcacttttgctggttccagtcaaatcaatggcatttaataaattttt...
position 1355 1466 1604 1614 1642 1734 1766 1783 1795 1806 1874
Synonym: HUM3CL
XR_244972.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens fasciculation and elongation protein zeta 2 (FEZ2), transcript variant 1, mRNA. (1993 bp)
aactgacagtatgcccatttgtttttatggctttcttatctaaactgcactgatgaactagattaaagccttgggagatttatactataaattcagtgatggcaagaaccaacactgtttttttgtgagaattgtcagtgtaactattacctaccagtattgttcagagagattgaaacagaataaacgggctgttcttgaagaagcaaaaccagaatatgcattactttggtttaatacttagtgctaacattgaaactgttggtggtgatggattttgtagcttgctgcttgtttcaccactggtcaaattttaaccattaaattgccattcacttttagaatcttgtatttaagttttgattttcaaatgttctgcttcatgtgtctgtgaagaattgtactttaagtgtgtgtcctctgaggtgcttgagaaagtgtacactgcagaactgcccattctcattactgtgtcctattttattcatgcctgtgtgtttttcttaagtatgaattctagatacagctacttatggattcatcaatatcatgagcacttttgctggttccagtcaaatcaatggcatttaataaattttt...
position 1409 1520 1658 1668 1696 1788 1820 1837 1849 1860 1928
Synonym: HUM3CL
NM_005102.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens fasciculation and elongation protein zeta 2 (FEZ2), transcript variant 2, mRNA. (2074 bp)
aactgacagtatgcccatttgtttttatggctttcttatctaaactgcactgatgaactagattaaagccttgggagatttatactataaattcagtgatggcaagaaccaacactgtttttttgtgagaattgtcagtgtaactattacctaccagtattgttcagagagattgaaacagaataaacgggctgttcttgaagaagcaaaaccagaatatgcattactttggtttaatacttagtgctaacattgaaactgttggtggtgatggattttgtagcttgctgcttgtttcaccactggtcaaattttaaccattaaattgccattcacttttagaatcttgtatttaagttttgattttcaaatgttctgcttcatgtgtctgtgaagaattgtactttaagtgtgtgtcctctgaggtgcttgagaaagtgtacactgcagaactgcccattctcattactgtgtcctattttattcatgcctgtgtgtttttcttaagtatgaattctagatacagctacttatggattcatcaatatcatgagcacttttgctggttccagtcaaatcaatggcatttaataaattttt...
position 1490 1601 1739 1749 1777 1869 1901 1918 1930 1941 2009
Synonym: HUM3CL
NM_001042548.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/215000_s_at
lang : en | div : | spe : hs | query_string : 215000_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.080 | 0.080 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTATTCATGCCTGTGTGTTTTTCT)?source=Homo sapiens (human)?to=0&format=json
0.088 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTAGCTTGCTGCTTGTTTCACCA)?source=Homo sapiens (human)?to=0&format=json
0.126 | 0.038 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATGAGCACTTTTGCTGGTTCCAG)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACACTGCAGAACTGCCCATTCTC)?source=Homo sapiens (human)?to=0&format=json
0.141 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTAACTATTACCTACCAGTATTGTT)?source=Homo sapiens (human)?to=0&format=json
0.149 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTTTCTTATCTAAACTGCACTGA)?source=Homo sapiens (human)?to=0&format=json
0.155 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGTGTCCTATTTTATTCATGCCTG)?source=Homo sapiens (human)?to=0&format=json
0.167 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCTTGTTTCACCACTGGTCAAAT)?source=Homo sapiens (human)?to=0&format=json
0.173 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCATTCTCATTACTGTGTCCTATTT)?source=Homo sapiens (human)?to=0&format=json
0.180 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTGTGTGTCCTCTGAGGTGCTTG)?source=Homo sapiens (human)?to=0&format=json
0.187 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACCATTAAATTGCCATTCACTTTT)?source=Homo sapiens (human)?to=0&format=json
0.288 | 0.101 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTATTCATGCCTGTGTGTTTTTCT)%26(nt:TTGTAGCTTGCTGCTTGTTTCACCA)%26(nt:TCATGAGCACTTTTGCTGGTTCCAG)%26(nt:GTACACTGCAGAACTGCCCATTCTC)%26(nt:GTAACTATTACCTACCAGTATTGTT)%26(nt:GGCTTTCTTATCTAAACTGCACTGA)%26(nt:CTGTGTCCTATTTTATTCATGCCTG)%26(nt:CTGCTTGTTTCACCACTGGTCAAAT)%26(nt:CCATTCTCATTACTGTGTCCTATTT)%26(nt:AAGTGTGTGTCCTCTGAGGTGCTTG)%26(nt:AACCATTAAATTGCCATTCACTTTT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.291 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]