GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-10-22 13:07:17, GGRNA : RefSeq release 90 (Sep, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens leucine rich repeats and calponin homology domain containing 1 (LRCH1), transcript variant 2, mRNA. (5490 bp)
ggacttagcttcctcaagataaatttctagtttattaagatgcaaacagctctcatagatggctactacgaagaaaatcttatttttctgaacattttcatgaatccaggggacttgaaaatatggaagacccacatagttagaagaatatatttataaagattccttgctgctaagtcagatcagatttgctaacaggaagcattctttacatgacagtatcttgagttatgtgagttttttttcctcctgactttgtgttgattggtgaaatgcagggtatgtggaagttatctaattaacctcagttgtatatgaataacccacagatgtactgaattacttttggtgctatcttgtactcttcaatctgtaacacaataaaatccctttgtacgatgtctaatgagcaccctgagccataaattgcttaataaacacattttgggtgattattccaagtttttatcagcccattgatacatgtattcatgagctctcagcattcccatccagctctgcagtgcattgaggcttctctttaatggtcaccactgtggtggtttttcccttctttctggggagaaaatgggaaaaaaa...
position 3762 3806 3877 3915 4059 4072 4098 4124 4204 4225 4247
Synonym: CHDC1; NP81
NM_015116.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens leucine rich repeats and calponin homology domain containing 1 (LRCH1), transcript variant 1, mRNA. (5595 bp)
ggacttagcttcctcaagataaatttctagtttattaagatgcaaacagctctcatagatggctactacgaagaaaatcttatttttctgaacattttcatgaatccaggggacttgaaaatatggaagacccacatagttagaagaatatatttataaagattccttgctgctaagtcagatcagatttgctaacaggaagcattctttacatgacagtatcttgagttatgtgagttttttttcctcctgactttgtgttgattggtgaaatgcagggtatgtggaagttatctaattaacctcagttgtatatgaataacccacagatgtactgaattacttttggtgctatcttgtactcttcaatctgtaacacaataaaatccctttgtacgatgtctaatgagcaccctgagccataaattgcttaataaacacattttgggtgattattccaagtttttatcagcccattgatacatgtattcatgagctctcagcattcccatccagctctgcagtgcattgaggcttctctttaatggtcaccactgtggtggtttttcccttctttctggggagaaaatgggaaaaaaa...
position 3867 3911 3982 4020 4164 4177 4203 4229 4309 4330 4352
Synonym: CHDC1; NP81
NM_001164211.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/214936_at
lang : en | div : | spe : hs | query_string : 214936_at | format : html | download :

0.000 | 0.000 | search_start;
0.082 | 0.082 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TAAAATCCCTTTGTACGATGTCTAA)?source=Homo sapiens (human)?to=0&format=json
0.090 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GATTCCTTGCTGCTAAGTCAGATCA)?source=Homo sapiens (human)?to=0&format=json
0.096 | 0.006 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAGGCTTCTCTTTAATGGTCACCAC)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAGCACCCTGAGCCATAAATTGCTT)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAAGCATTCTTTACATGACAGTATC)?source=Homo sapiens (human)?to=0&format=json
0.116 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAACATTTTCATGAATCCAGGGGAC)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTTTTGGTGCTATCTTGTACTCTTC)?source=Homo sapiens (human)?to=0&format=json
0.129 | 0.006 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTTGTACTCTTCAATCTGTAACACA)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.006 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CCATCCAGCTCTGCAGTGCATTGAG)?source=Homo sapiens (human)?to=0&format=json
0.141 | 0.006 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ATTCATGAGCTCTCAGCATTCCCAT)?source=Homo sapiens (human)?to=0&format=json
0.148 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ACAGCTCTCATAGATGGCTACTACG)?source=Homo sapiens (human)?to=0&format=json
0.212 | 0.064 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TAAAATCCCTTTGTACGATGTCTAA)%26(nt:GATTCCTTGCTGCTAAGTCAGATCA)%26(nt:GAGGCTTCTCTTTAATGGTCACCAC)%26(nt:GAGCACCCTGAGCCATAAATTGCTT)%26(nt:GAAGCATTCTTTACATGACAGTATC)%26(nt:GAACATTTTCATGAATCCAGGGGAC)%26(nt:CTTTTGGTGCTATCTTGTACTCTTC)%26(nt:CTTGTACTCTTCAATCTGTAACACA)%26(nt:CCATCCAGCTCTGCAGTGCATTGAG)%26(nt:ATTCATGAGCTCTCAGCATTCCCAT)%26(nt:ACAGCTCTCATAGATGGCTACTACG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.214 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]