GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-12-12 07:15:14, GGRNA : RefSeq release 91 (Nov, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens luteinizing hormone beta polypeptide (LHB), transcript variant X1, mRNA. (597 bp)
ORIGIN // gtctctgggtctttgtgggtggtgtaccacgcgggatgggaaggccaggactcggggctgcggtctcagacctgggtgaagcagtgtccttgtcccaggggctgctgctgttgctgctgctgagcatgggcggggcatgggcatccagggagccgcttcggccatggtgccaccccatcaatgccatcctggctgtcgagaaggagggctgcccagtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgatgcgcgtgctgcaggcggtcctgccgcccctgcctcaggtggtgtgcacctaccgtgatgtgcgcttcgagtccatccggctccctggctgcccgcgtggtgtggaccccgtggtctccttccctgtggctctcagctgtcgctgtggaccctgccgccgcagcacctctgactgtgggggtcccaaagaccaccccttgacctgtgaccacccccaactctcaggcctcctcttcctctaaagaccctccccgcagccttccaagtccatcccgactcctggagccctgacaccccgatcctcccacaataaaggcttctca...
position 108 118 121 298 300 302 307 310 432 434 437
Synonym: CGB4; HH23; LSH-B; LSH-beta
XM_011526975.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens luteinizing hormone beta polypeptide (LHB), mRNA. (523 bp)
of the beta-subunit JOURNAL Biochim. Biophys. Acta 412 (1), 70-81 (1975) PUBMED 1191677 gcaccaaggatggagatgctccaggggctgctgctgttgctgctgctgagcatgggcggggcatgggcatccagggagccgcttcggccatggtgccaccccatcaatgccatcctggctgtcgagaaggagggctgcccagtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgatgcgcgtgctgcaggcggtcctgccgcccctgcctcaggtggtgtgcacctaccgtgatgtgcgcttcgagtccatccggctccctggctgcccgcgtggtgtggaccccgtggtctccttccctgtggctctcagctgtcgctgtggaccctgccgccgcagcacctctgactgtgggggtcccaaagaccaccccttgacctgtgaccacccccaactctcaggcctcctcttcctctaaagaccctccccgcagccttccaagtccatcccgactcctggagccctgacaccccgatcctcccacaataaaggctt...
position 34 44 47 224 226 228 233 236 358 360 363
Synonym: CGB4; HH23; LSH-B; LSH-beta
NM_000894.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/214471_x_at
lang : en | div : | spe : hs | query_string : 214471_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGCACCTACCGTGATGTGCGCTT)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGTGTGCACCTACCGTGATGTGCG)?source=Homo sapiens (human)?to=0&format=json
0.114 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCTGAGCATGGGCGGGGCATGGGC)?source=Homo sapiens (human)?to=0&format=json
0.127 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCTCAGGTGGTGTGCACCTACCG)?source=Homo sapiens (human)?to=0&format=json
0.136 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAGCATGGGCGGGGCATGGGCATC)?source=Homo sapiens (human)?to=0&format=json
0.146 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGACTGTGGGGGTCCCAAAGACCAC)?source=Homo sapiens (human)?to=0&format=json
0.156 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAGGTGGTGTGCACCTACCGTGAT)?source=Homo sapiens (human)?to=0&format=json
0.166 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGTTGCTGCTGCTGAGCATGGGCG)?source=Homo sapiens (human)?to=0&format=json
0.175 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGACTGTGGGGGTCCCAAAGAC)?source=Homo sapiens (human)?to=0&format=json
0.184 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTCAGGTGGTGTGCACCTACCGTG)?source=Homo sapiens (human)?to=0&format=json
0.195 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCTCTGACTGTGGGGGTCCCAAAG)?source=Homo sapiens (human)?to=0&format=json
0.217 | 0.023 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGCACCTACCGTGATGTGCGCTT)%26(nt:TGGTGTGCACCTACCGTGATGTGCG)%26(nt:TGCTGAGCATGGGCGGGGCATGGGC)%26(nt:TGCCTCAGGTGGTGTGCACCTACCG)%26(nt:TGAGCATGGGCGGGGCATGGGCATC)%26(nt:TGACTGTGGGGGTCCCAAAGACCAC)%26(nt:TCAGGTGGTGTGCACCTACCGTGAT)%26(nt:CTGTTGCTGCTGCTGAGCATGGGCG)%26(nt:CTCTGACTGTGGGGGTCCCAAAGAC)%26(nt:CCTCAGGTGGTGTGCACCTACCGTG)%26(nt:ACCTCTGACTGTGGGGGTCCCAAAG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.219 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]