GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:03:03, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens alcohol dehydrogenase 6 (class V) (ADH6), transcript variant 3, non-coding RNA. (2443 bp)
catacacacaagagttcccttcctagttgcagactcttctgctccagctggactcccctagctctggactcccactagatcacacaggggtccctgcatgtcagtaaactttggatgaccttgggagaccaaaaaatggaatatcattttttgatctaaacaaaatagtttcctgatttaacactggccaggaaggtgggctgcaccctcagtctctctctcccatcatggttttcacatgatatcaaaggactctcataacagtctgattcttatgagttgggcatcctgtgtttccctttaggggcctgcttccttcaaatagaggagatgggtgctatgaaacctattcactctggacttgggatggctcttctccatcttcccaagtctgagctggagcctccatgcccaactctgctctgctcttctatttcctgacagcagctaaggcatgttcctgttctgcccccaaattgaccttactaacagtgagaacttggaggagtcttcgggtcttgggaaatccaagttttcccggaaacgttttgttgtaaacagtgtccacactctttgctccaataaagctcggttccttaa...
position 1862 1905 2107 2144 2171 2188 2272 2286 2306 2335 2394
Synonym: ADH-5
NR_132990.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens alcohol dehydrogenase 6 (class V) (ADH6), transcript variant 1, mRNA. (2802 bp)
catacacacaagagttcccttcctagttgcagactcttctgctccagctggactcccctagctctggactcccactagatcacacaggggtccctgcatgtcagtaaactttggatgaccttgggagaccaaaaaatggaatatcattttttgatctaaacaaaatagtttcctgatttaacactggccaggaaggtgggctgcaccctcagtctctctctcccatcatggttttcacatgatatcaaaggactctcataacagtctgattcttatgagttgggcatcctgtgtttccctttaggggcctgcttccttcaaatagaggagatgggtgctatgaaacctattcactctggacttgggatggctcttctccatcttcccaagtctgagctggagcctccatgcccaactctgctctgctcttctatttcctgacagcagctaaggcatgttcctgttctgcccccaaattgaccttactaacagtgagaacttggaggagtcttcgggtcttgggaaatccaagttttcccggaaacgttttgttgtaaacagtgtccacactctttgctccaataaagctcggttccttaa...
position 2221 2264 2466 2503 2530 2547 2631 2645 2665 2694 2753
Synonym: ADH-5
NM_001102470.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens alcohol dehydrogenase 6 (class V) (ADH6), transcript variant 2, mRNA. (3483 bp)
catacacacaagagttcccttcctagttgcagactcttctgctccagctggactcccctagctctggactcccactagatcacacaggggtccctgcatgtcagtaaactttggatgaccttgggagaccaaaaaatggaatatcattttttgatctaaacaaaatagtttcctgatttaacactggccaggaaggtgggctgcaccctcagtctctctctcccatcatggttttcacatgatatcaaaggactctcataacagtctgattcttatgagttgggcatcctgtgtttccctttaggggcctgcttccttcaaatagaggagatgggtgctatgaaacctattcactctggacttgggatggctcttctccatcttcccaagtctgagctggagcctccatgcccaactctgctctgctcttctatttcctgacagcagctaaggcatgttcctgttctgcccccaaattgaccttactaacagtgagaacttggaggagtcttcgggtcttgggaaatccaagttttcccggaaacgttttgttgtaaacagtgtccacactctttgctccaataaagctcggttccttaa...
position 2902 2945 3147 3184 3211 3228 3312 3326 3346 3375 3434
Synonym: ADH-5
NM_000672.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/214261_s_at
lang : en | div : | spe : hs | query_string : 214261_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGTGCTATGAAACCTATTCACTC)?source=Homo sapiens (human)?to=0&format=json
0.098 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCCCCAAATTGACCTTACTAACA)?source=Homo sapiens (human)?to=0&format=json
0.110 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAACAGTGTCCACACTCTTTGCTC)?source=Homo sapiens (human)?to=0&format=json
0.122 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGCCTGCTTCCTTCAAATAGAGGA)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACTCCCACTAGATCACACAGGGG)?source=Homo sapiens (human)?to=0&format=json
0.142 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTAAGGCATGTTCCTGTTCTGCCC)?source=Homo sapiens (human)?to=0&format=json
0.153 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATTCTTATGAGTTGGGCATCCTGT)?source=Homo sapiens (human)?to=0&format=json
0.164 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACTTGGAGGAGTCTTCGGGTCTT)?source=Homo sapiens (human)?to=0&format=json
0.174 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTAGTTGCAGACTCTTCTGCTCCAG)?source=Homo sapiens (human)?to=0&format=json
0.184 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTCCTGACAGCAGCTAAGGCATG)?source=Homo sapiens (human)?to=0&format=json
0.195 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTCACTCTGGACTTGGGATGGCTC)?source=Homo sapiens (human)?to=0&format=json
0.255 | 0.060 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGTGCTATGAAACCTATTCACTC)%26(nt:TGCCCCCAAATTGACCTTACTAACA)%26(nt:TAAACAGTGTCCACACTCTTTGCTC)%26(nt:GGGCCTGCTTCCTTCAAATAGAGGA)%26(nt:GGACTCCCACTAGATCACACAGGGG)%26(nt:GCTAAGGCATGTTCCTGTTCTGCCC)%26(nt:GATTCTTATGAGTTGGGCATCCTGT)%26(nt:GAACTTGGAGGAGTCTTCGGGTCTT)%26(nt:CTAGTTGCAGACTCTTCTGCTCCAG)%26(nt:ATTTCCTGACAGCAGCTAAGGCATG)%26(nt:ATTCACTCTGGACTTGGGATGGCTC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.257 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]