GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:39:53, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L24 (RPL24), mRNA. (560 bp)
tcggctttcctttccaagaggaatcctcggcagataaactggactgtcctctacagaaggaagcacaaaaagggacagtcggaagaaattcaaaagaaaagaacccgccgagcagtcaaattccagagggccattactggtgcatctcttgctgatataatggccaagaggaatcagaaacctgaagttagaaaggctcaacgagaacaagctatcagggctgctaaggaagcaaaaaaggctaagcaagcatctaaaaagactgcaatggctgctgctaaggcacctacaaaggcagcacctaagcaaaagattgtgaagcctgtgaaagtttcagctccccgagttggtggaaaacgctaaactggcagattagatttttaaataaagattggattataactcta
position 393 410 419 424 433 436 463 472 485 490 504
Synonym: HEL-S-310; L24
NM_000986.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/214143_x_at
lang : en | div : | spe : hs | query_string : 214143_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCAGCTCCCCGAGTTGGTGGAAA)?source=Homo sapiens (human)?to=0&format=json
0.099 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGAAAACGCTAAACTGGCAGATTA)?source=Homo sapiens (human)?to=0&format=json
0.109 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTAAGCAAGCATCTAAAAAGACT)?source=Homo sapiens (human)?to=0&format=json
0.119 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGCTGCTAAGGCACCTACAAAGG)?source=Homo sapiens (human)?to=0&format=json
0.130 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTCCCCGAGTTGGTGGAAAACGCT)?source=Homo sapiens (human)?to=0&format=json
0.139 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCACCTACAAAGGCAGCACCTAAGC)?source=Homo sapiens (human)?to=0&format=json
0.148 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAATGGCTGCTGCTAAGGCACCTAC)?source=Homo sapiens (human)?to=0&format=json
0.157 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGGCACCTACAAAGGCAGCACCTA)?source=Homo sapiens (human)?to=0&format=json
0.168 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGCCTGTGAAAGTTTCAGCTCCCC)?source=Homo sapiens (human)?to=0&format=json
0.179 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGATTGTGAAGCCTGTGAAAGTTT)?source=Homo sapiens (human)?to=0&format=json
0.188 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAAGACTGCAATGGCTGCTGCTAA)?source=Homo sapiens (human)?to=0&format=json
0.208 | 0.019 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCAGCTCCCCGAGTTGGTGGAAA)%26(nt:TGGAAAACGCTAAACTGGCAGATTA)%26(nt:GGCTAAGCAAGCATCTAAAAAGACT)%26(nt:GCTGCTGCTAAGGCACCTACAAAGG)%26(nt:GCTCCCCGAGTTGGTGGAAAACGCT)%26(nt:GCACCTACAAAGGCAGCACCTAAGC)%26(nt:CAATGGCTGCTGCTAAGGCACCTAC)%26(nt:AAGGCACCTACAAAGGCAGCACCTA)%26(nt:AAGCCTGTGAAAGTTTCAGCTCCCC)%26(nt:AAGATTGTGAAGCCTGTGAAAGTTT)%26(nt:AAAAGACTGCAATGGCTGCTGCTAA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.208 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]