GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:30:31, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens RWD domain containing 2A (RWDD2A), transcript variant 2, mRNA. (3550 bp)
tgactggattttgcatgacaggaaagcctggtataatctgtgtggagggtttcaaagagcactgtgaggagttctggcacacaattaggtaccccaattggaagcacatttcctgtaagcatgctgaaagcgtggagacagaaggaaatggtgaggacctgcgccttttccattcttttgaagagttactccttgaggctcatggtgactatggattaaggaatgactatcacatgaatctgggccaattcttagaatttctcaagaagcacaaaagtgagcatgtttttcagatactatttggtattgaaagcaaaagttcagactcataaaaagcgattaagaggcctatgcctgtaatttcactaagtcagtatttctgttaataagaccaaattaaaaaggctagtggctgtgtagcatcctcagtgcaaaacccagctccagaattttcacctggtaacgaatttcaactgacagtgaaatgaataggcctttaaactttataacattgcaattgtgatgttatctctaggtttttgtgtgaagtcattcaaaaactatttcattgtaaattaataaaaacaatccatttaactt...
position 611 626 643 659 700 716 737 780 959 971 1077
Synonym: dJ747H23.2; RWDD2
NM_001322335.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens RWD domain containing 2A (RWDD2A), transcript variant 5, mRNA. (3642 bp)
tgactggattttgcatgacaggaaagcctggtataatctgtgtggagggtttcaaagagcactgtgaggagttctggcacacaattaggtaccccaattggaagcacatttcctgtaagcatgctgaaagcgtggagacagaaggaaatggtgaggacctgcgccttttccattcttttgaagagttactccttgaggctcatggtgactatggattaaggaatgactatcacatgaatctgggccaattcttagaatttctcaagaagcacaaaagtgagcatgtttttcagatactatttggtattgaaagcaaaagttcagactcataaaaagcgattaagaggcctatgcctgtaatttcactaagtcagtatttctgttaataagaccaaattaaaaaggctagtggctgtgtagcatcctcagtgcaaaacccagctccagaattttcacctggtaacgaatttcaactgacagtgaaatgaataggcctttaaactttataacattgcaattgtgatgttatctctaggtttttgtgtgaagtcattcaaaaactatttcattgtaaattaataaaaacaatccatttaactt...
position 703 718 735 751 792 808 829 872 1051 1063 1169
Synonym: dJ747H23.2; RWDD2
NM_001322339.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens RWD domain containing 2A (RWDD2A), transcript variant 1, mRNA. (3769 bp)
tgactggattttgcatgacaggaaagcctggtataatctgtgtggagggtttcaaagagcactgtgaggagttctggcacacaattaggtaccccaattggaagcacatttcctgtaagcatgctgaaagcgtggagacagaaggaaatggtgaggacctgcgccttttccattcttttgaagagttactccttgaggctcatggtgactatggattaaggaatgactatcacatgaatctgggccaattcttagaatttctcaagaagcacaaaagtgagcatgtttttcagatactatttggtattgaaagcaaaagttcagactcataaaaagcgattaagaggcctatgcctgtaatttcactaagtcagtatttctgttaataagaccaaattaaaaaggctagtggctgtgtagcatcctcagtgcaaaacccagctccagaattttcacctggtaacgaatttcaactgacagtgaaatgaataggcctttaaactttataacattgcaattgtgatgttatctctaggtttttgtgtgaagtcattcaaaaactatttcattgtaaattaataaaaacaatccatttaactt...
position 830 845 862 878 919 935 956 999 1178 1190 1296
Synonym: dJ747H23.2; RWDD2
NM_033411.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens RWD domain containing 2A (RWDD2A), transcript variant 4, mRNA. (3846 bp)
tgactggattttgcatgacaggaaagcctggtataatctgtgtggagggtttcaaagagcactgtgaggagttctggcacacaattaggtaccccaattggaagcacatttcctgtaagcatgctgaaagcgtggagacagaaggaaatggtgaggacctgcgccttttccattcttttgaagagttactccttgaggctcatggtgactatggattaaggaatgactatcacatgaatctgggccaattcttagaatttctcaagaagcacaaaagtgagcatgtttttcagatactatttggtattgaaagcaaaagttcagactcataaaaagcgattaagaggcctatgcctgtaatttcactaagtcagtatttctgttaataagaccaaattaaaaaggctagtggctgtgtagcatcctcagtgcaaaacccagctccagaattttcacctggtaacgaatttcaactgacagtgaaatgaataggcctttaaactttataacattgcaattgtgatgttatctctaggtttttgtgtgaagtcattcaaaaactatttcattgtaaattaataaaaacaatccatttaactt...
position 907 922 939 955 996 1012 1033 1076 1255 1267 1373
Synonym: dJ747H23.2; RWDD2
NM_001322337.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens RWD domain containing 2A (RWDD2A), transcript variant 3, mRNA. (3861 bp)
tgactggattttgcatgacaggaaagcctggtataatctgtgtggagggtttcaaagagcactgtgaggagttctggcacacaattaggtaccccaattggaagcacatttcctgtaagcatgctgaaagcgtggagacagaaggaaatggtgaggacctgcgccttttccattcttttgaagagttactccttgaggctcatggtgactatggattaaggaatgactatcacatgaatctgggccaattcttagaatttctcaagaagcacaaaagtgagcatgtttttcagatactatttggtattgaaagcaaaagttcagactcataaaaagcgattaagaggcctatgcctgtaatttcactaagtcagtatttctgttaataagaccaaattaaaaaggctagtggctgtgtagcatcctcagtgcaaaacccagctccagaattttcacctggtaacgaatttcaactgacagtgaaatgaataggcctttaaactttataacattgcaattgtgatgttatctctaggtttttgtgtgaagtcattcaaaaactatttcattgtaaattaataaaaacaatccatttaactt...
position 922 937 954 970 1011 1027 1048 1091 1270 1282 1388
Synonym: dJ747H23.2; RWDD2
NM_001322336.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens RWD domain containing 2A (RWDD2A), transcript variant X2, mRNA. (4168 bp)
tgactggattttgcatgacaggaaagcctggtataatctgtgtggagggtttcaaagagcactgtgaggagttctggcacacaattaggtaccccaattggaagcacatttcctgtaagcatgctgaaagcgtggagacagaaggaaatggtgaggacctgcgccttttccattcttttgaagagttactccttgaggctcatggtgactatggattaaggaatgactatcacatgaatctgggccaattcttagaatttctcaagaagcacaaaagtgagcatgtttttcagatactatttggtattgaaagcaaaagttcagactcataaaaagcgattaagaggcctatgcctgtaatttcactaagtcagtatttctgttaataagaccaaattaaaaaggctagtggctgtgtagcatcctcagtgcaaaacccagctccagaattttcacctggtaacgaatttcaactgacagtgaaatgaataggcctttaaactttataacattgcaattgtgatgttatctctaggtttttgtgtgaagtcattcaaaaactatttcattgtaaattaataaaaacaatccatttaactt...
position 1232 1247 1264 1280 1321 1337 1358 1401 1580 1592 1698
Synonym: dJ747H23.2; RWDD2
XM_017010223.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens RWD domain containing 2A (RWDD2A), transcript variant X1, mRNA. (4385 bp)
tgactggattttgcatgacaggaaagcctggtataatctgtgtggagggtttcaaagagcactgtgaggagttctggcacacaattaggtaccccaattggaagcacatttcctgtaagcatgctgaaagcgtggagacagaaggaaatggtgaggacctgcgccttttccattcttttgaagagttactccttgaggctcatggtgactatggattaaggaatgactatcacatgaatctgggccaattcttagaatttctcaagaagcacaaaagtgagcatgtttttcagatactatttggtattgaaagcaaaagttcagactcataaaaagcgattaagaggcctatgcctgtaatttcactaagtcagtatttctgttaataagaccaaattaaaaaggctagtggctgtgtagcatcctcagtgcaaaacccagctccagaattttcacctggtaacgaatttcaactgacagtgaaatgaataggcctttaaactttataacattgcaattgtgatgttatctctaggtttttgtgtgaagtcattcaaaaactatttcattgtaaattaataaaaacaatccatttaactt...
position 1449 1464 1481 1497 1538 1554 1575 1618 1797 1809 1915
Synonym: dJ747H23.2; RWDD2
XM_017010222.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/213555_at
lang : en | div : | spe : hs | query_string : 213555_at | format : html | download :

0.000 | 0.000 | search_start;
0.088 | 0.088 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAGCATCCTCAGTGCAAAACCCA)?source=Homo sapiens (human)?to=0&format=json
0.099 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTCTGGCACACAATTAGGTACCCC)?source=Homo sapiens (human)?to=0&format=json
0.111 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTACCCCAATTGGAAGCACATTTC)?source=Homo sapiens (human)?to=0&format=json
0.122 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTAGTGGCTGTGTAGCATCCTCA)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGCCTTTTCCATTCTTTTGAAGAG)?source=Homo sapiens (human)?to=0&format=json
0.146 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCACATTTCCTGTAAGCATGCTGAA)?source=Homo sapiens (human)?to=0&format=json
0.157 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATGTTATCTCTAGGTTTTTGTGTG)?source=Homo sapiens (human)?to=0&format=json
0.169 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTATCACATGAATCTGGGCCAAT)?source=Homo sapiens (human)?to=0&format=json
0.256 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAATGGTGAGGACCTGCGCCTTTT)?source=Homo sapiens (human)?to=0&format=json
0.268 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAGTTACTCCTTGAGGCTCATGGT)?source=Homo sapiens (human)?to=0&format=json
0.291 | 0.024 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAGCACTGTGAGGAGTTCTGGCAC)?source=Homo sapiens (human)?to=0&format=json
0.454 | 0.163 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAGCATCCTCAGTGCAAAACCCA)%26(nt:GTTCTGGCACACAATTAGGTACCCC)%26(nt:GGTACCCCAATTGGAAGCACATTTC)%26(nt:GGCTAGTGGCTGTGTAGCATCCTCA)%26(nt:GCGCCTTTTCCATTCTTTTGAAGAG)%26(nt:GCACATTTCCTGTAAGCATGCTGAA)%26(nt:GATGTTATCTCTAGGTTTTTGTGTG)%26(nt:GACTATCACATGAATCTGGGCCAAT)%26(nt:GAAATGGTGAGGACCTGCGCCTTTT)%26(nt:AGAGTTACTCCTTGAGGCTCATGGT)%26(nt:AGAGCACTGTGAGGAGTTCTGGCAC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.459 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]