GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-10-22 12:58:40, GGRNA : RefSeq release 90 (Sep, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X8, mRNA. (3339 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 1557 1570 1579 1603 1613 1623 1627 1652 1657 1765 1770
Synonym: APPS; CPSB
XM_017013101.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X6, mRNA. (3816 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2034 2047 2056 2080 2090 2100 2104 2129 2134 2242 2247
Synonym: APPS; CPSB
XM_017013100.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X1, mRNA. (3872 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2090 2103 2112 2136 2146 2156 2160 2185 2190 2298 2303
Synonym: APPS; CPSB
XM_017013097.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X3, mRNA. (3893 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2111 2124 2133 2157 2167 2177 2181 2206 2211 2319 2324
Synonym: APPS; CPSB
XM_011543812.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X5, mRNA. (3914 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2132 2145 2154 2178 2188 2198 2202 2227 2232 2340 2345
Synonym: APPS; CPSB
XM_017013099.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X2, mRNA. (3929 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2147 2160 2169 2193 2203 2213 2217 2242 2247 2355 2360
Synonym: APPS; CPSB
XM_024447071.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X4, mRNA. (3982 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2200 2213 2222 2246 2256 2266 2270 2295 2300 2408 2413
Synonym: APPS; CPSB
XM_006716244.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens cathepsin B (CTSB), transcript variant X7, mRNA. (4086 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2304 2317 2326 2350 2360 2370 2374 2399 2404 2512 2517
Synonym: APPS; CPSB
XM_006716245.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cathepsin B (CTSB), transcript variant 6, mRNA. (3773 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 1983 1996 2005 2029 2039 2049 2053 2078 2083 2191 2196
Synonym: APPS; CPSB
NM_001317237.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cathepsin B (CTSB), transcript variant 1, mRNA. (3804 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2014 2027 2036 2060 2070 2080 2084 2109 2114 2222 2227
Synonym: APPS; CPSB
NM_001908.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cathepsin B (CTSB), transcript variant 5, mRNA. (3878 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2088 2101 2110 2134 2144 2154 2158 2183 2188 2296 2301
Synonym: APPS; CPSB
NM_147783.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cathepsin B (CTSB), transcript variant 4, mRNA. (3892 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2102 2115 2124 2148 2158 2168 2172 2197 2202 2310 2315
Synonym: APPS; CPSB
NM_147782.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cathepsin B (CTSB), transcript variant 3, mRNA. (3923 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2133 2146 2155 2179 2189 2199 2203 2228 2233 2341 2346
Synonym: APPS; CPSB
NM_147781.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens cathepsin B (CTSB), transcript variant 2, mRNA. (3966 bp)
cggctcaaaaggaaaccaagtggtcaggagttgtttctgacccactgatctctactaccacaaggaaaatagtttaggagaaaccagcttttactgtttttgaaaaattacagcttcaccctgtcaagttaacaaggaatgcctgtgccaataaaagttttctccaacttgaagtctactctgatgggatctcagatcctttgtcactgcctatagacttgtagctgctgtctctctttgtccctgcagagaatcacgtcctggaactgcatgttcttgcgactcttgggacttcatcttaacttctcgctgccccagccatgttttcaaccatggcatccctcccccaattagttccctgtcatcctcgtcaaccttctctgtaagtgcctggtaagcttgcccttgcttaagaactcaaaacatagctgtgctctatttttttgttgttgttgtgactgacagagtgagattccgtctcccaggctggagtgcagtggcgccttctcagctcactgcaacctgcagcctcctagattcaagcgattctcctgcttcagccttccgagtagctgggatgacaggcactcaccaatatgc...
position 2176 2189 2198 2222 2232 2242 2246 2271 2276 2384 2389
Synonym: APPS; CPSB
NM_147780.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/213274_s_at
lang : en | div : | spe : hs | query_string : 213274_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.079 | 0.078 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGGGATCTCAGATCCTTTGTCACTG)?source=Homo sapiens (human)?to=0&format=json
0.086 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCTCTCTTTGTCCCTGCAGAGAATC)?source=Homo sapiens (human)?to=0&format=json
0.092 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCCCTGCAGAGAATCACGTCCTGGA)?source=Homo sapiens (human)?to=0&format=json
0.100 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GGTAAGCTTGCCCTTGCTTAAGAAC)?source=Homo sapiens (human)?to=0&format=json
0.107 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCTTGCCCTTGCTTAAGAACTCAAA)?source=Homo sapiens (human)?to=0&format=json
0.117 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAATCACGTCCTGGAACTGCATGTT)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTTGGGACTTCATCTTAACTTCTCG)?source=Homo sapiens (human)?to=0&format=json
0.131 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTGCCTATAGACTTGTAGCTGCTGT)?source=Homo sapiens (human)?to=0&format=json
0.138 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGACTCTTGGGACTTCATCTTAACT)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CCTTTGTCACTGCCTATAGACTTGT)?source=Homo sapiens (human)?to=0&format=json
0.152 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CACGTCCTGGAACTGCATGTTCTTG)?source=Homo sapiens (human)?to=0&format=json
0.377 | 0.224 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGGGATCTCAGATCCTTTGTCACTG)%26(nt:TCTCTCTTTGTCCCTGCAGAGAATC)%26(nt:TCCCTGCAGAGAATCACGTCCTGGA)%26(nt:GGTAAGCTTGCCCTTGCTTAAGAAC)%26(nt:GCTTGCCCTTGCTTAAGAACTCAAA)%26(nt:GAATCACGTCCTGGAACTGCATGTT)%26(nt:CTTGGGACTTCATCTTAACTTCTCG)%26(nt:CTGCCTATAGACTTGTAGCTGCTGT)%26(nt:CGACTCTTGGGACTTCATCTTAACT)%26(nt:CCTTTGTCACTGCCTATAGACTTGT)%26(nt:CACGTCCTGGAACTGCATGTTCTTG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.385 | 0.009 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]