GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:32:22, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens progesterone receptor membrane component 2 (PGRMC2), mRNA. (2769 bp)
atactagacaattagcactccaggtggttattgaacacaaaacagtaaaagaatattgcactgatagatactaaattattattttattaggttgaaaaagcccttactaaaagcccctcatatatcaattactttatttcattatgactacttaggttccgggctggggacaagttcacttaaaaaggcaatgttatttaacaggtcaccagttaagacttctgctttgtagatacatgcagaagccatcaaacaagggggagcttttaactgcaacaataagctaaagtatgtaaaatactacattctattcagtcttggagtgttttgtagaaagttatcttcagccaaatctttgctgaagactggttgtggagtgttggtaaatgctttgtgtttttatgtaaaatattttctaaacaaaaaatgttaaaagtacatgtcctctgtagtaaactgatatctatatatatgaatcattcaagcctaaagtctagtaataaactgtacttgtgaatagagaaaccctaaatattcatgcagaaaaaattatgcggtctgttaagaaaaatgagtaatttgtgttttggacttgaaata...
position 2244 2254 2284 2299 2347 2443 2471 2500 2516 2580 2617
Synonym: DG6; PMBP
NM_006320.6 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/213227_at
lang : en | div : | spe : hs | query_string : 213227_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCGGGCTGGGGACAAGTTCACTT)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.018 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATGACTACTTAGGTTCCGGGCTG)?source=Homo sapiens (human)?to=0&format=json
0.116 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTAGAAAGTTATCTTCAGCCAAAT)?source=Homo sapiens (human)?to=0&format=json
0.126 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCACCAGTTAAGACTTCTGCTTTG)?source=Homo sapiens (human)?to=0&format=json
0.137 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGTGTTGGTAAATGCTTTGTGTT)?source=Homo sapiens (human)?to=0&format=json
0.148 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGAAGACTGGTTGTGGAGTGTTG)?source=Homo sapiens (human)?to=0&format=json
0.158 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTACATTCTATTCAGTCTTGGAGTG)?source=Homo sapiens (human)?to=0&format=json
0.168 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTTACTAAAAGCCCCTCATATATC)?source=Homo sapiens (human)?to=0&format=json
0.179 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCCCCTCATATATCAATTACTTTA)?source=Homo sapiens (human)?to=0&format=json
0.190 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACATGTCCTCTGTAGTAAACTGATA)?source=Homo sapiens (human)?to=0&format=json
0.201 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATCATTCAAGCCTAAAGTCTAGTA)?source=Homo sapiens (human)?to=0&format=json
0.230 | 0.029 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCGGGCTGGGGACAAGTTCACTT)%26(nt:TTATGACTACTTAGGTTCCGGGCTG)%26(nt:TGTAGAAAGTTATCTTCAGCCAAAT)%26(nt:GTCACCAGTTAAGACTTCTGCTTTG)%26(nt:GGAGTGTTGGTAAATGCTTTGTGTT)%26(nt:GCTGAAGACTGGTTGTGGAGTGTTG)%26(nt:CTACATTCTATTCAGTCTTGGAGTG)%26(nt:CCTTACTAAAAGCCCCTCATATATC)%26(nt:AGCCCCTCATATATCAATTACTTTA)%26(nt:ACATGTCCTCTGTAGTAAACTGATA)%26(nt:AATCATTCAAGCCTAAAGTCTAGTA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.231 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]