GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:06:47, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 10, mRNA. (4754 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4166 4183 4203 4286 4358 4407 4525 4591 4644 4664 4708
Synonym: ANKRD15; CPSQ2; KANK
NM_001354336.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 13, mRNA. (4757 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4169 4186 4206 4289 4361 4410 4528 4594 4647 4667 4711
Synonym: ANKRD15; CPSQ2; KANK
NM_001354339.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 5, mRNA. (4830 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4242 4259 4279 4362 4434 4483 4601 4667 4720 4740 4784
Synonym: ANKRD15; CPSQ2; KANK
NM_001354331.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 16, mRNA. (4845 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4257 4274 4294 4377 4449 4498 4616 4682 4735 4755 4799
Synonym: ANKRD15; CPSQ2; KANK
NM_001354342.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 17, mRNA. (4849 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4261 4278 4298 4381 4453 4502 4620 4686 4739 4759 4803
Synonym: ANKRD15; CPSQ2; KANK
NM_001354343.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 14, mRNA. (4939 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4351 4368 4388 4471 4543 4592 4710 4776 4829 4849 4893
Synonym: ANKRD15; CPSQ2; KANK
NM_001354340.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 12, mRNA. (4943 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4355 4372 4392 4475 4547 4596 4714 4780 4833 4853 4897
Synonym: ANKRD15; CPSQ2; KANK
NM_001354338.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X15, mRNA. (4955 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4366 4383 4403 4486 4558 4607 4725 4791 4844 4864 4908
Synonym: ANKRD15; CPSQ2; KANK
XM_024447471.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 11, mRNA. (4997 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4409 4426 4446 4529 4601 4650 4768 4834 4887 4907 4951
Synonym: ANKRD15; CPSQ2; KANK
NM_001354337.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 6, mRNA. (5016 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4428 4445 4465 4548 4620 4669 4787 4853 4906 4926 4970
Synonym: ANKRD15; CPSQ2; KANK
NM_001354332.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 18, mRNA. (5031 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4443 4460 4480 4563 4635 4684 4802 4868 4921 4941 4985
Synonym: ANKRD15; CPSQ2; KANK
NM_001354344.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X12, mRNA. (5044 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4455 4472 4492 4575 4647 4696 4814 4880 4933 4953 4997
Synonym: ANKRD15; CPSQ2; KANK
XM_017014522.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X9, mRNA. (5046 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4458 4475 4495 4578 4650 4699 4817 4883 4936 4956 5000
Synonym: ANKRD15; CPSQ2; KANK
XM_024447468.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 9, mRNA. (5048 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4460 4477 4497 4580 4652 4701 4819 4885 4938 4958 5002
Synonym: ANKRD15; CPSQ2; KANK
NM_001354335.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 19, non-coding RNA. (5055 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4467 4484 4504 4587 4659 4708 4826 4892 4945 4965 5009
Synonym: ANKRD15; CPSQ2; KANK
NR_148869.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 1, mRNA. (5070 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4482 4499 4519 4602 4674 4723 4841 4907 4960 4980 5024
Synonym: ANKRD15; CPSQ2; KANK
NM_015158.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 2, mRNA. (5085 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4497 4514 4534 4617 4689 4738 4856 4922 4975 4995 5039
Synonym: ANKRD15; CPSQ2; KANK
NM_153186.6 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 15, mRNA. (5089 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4501 4518 4538 4621 4693 4742 4860 4926 4979 4999 5043
Synonym: ANKRD15; CPSQ2; KANK
NM_001354341.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 7, mRNA. (5103 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4515 4532 4552 4635 4707 4756 4874 4940 4993 5013 5057
Synonym: ANKRD15; CPSQ2; KANK
NM_001354333.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X8, mRNA. (5105 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4517 4534 4554 4637 4709 4758 4876 4942 4995 5015 5059
Synonym: ANKRD15; CPSQ2; KANK
XM_024447467.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X6, mRNA. (5161 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4573 4590 4610 4693 4765 4814 4932 4998 5051 5071 5115
Synonym: ANKRD15; CPSQ2; KANK
XM_024447465.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X7, mRNA. (5178 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4590 4607 4627 4710 4782 4831 4949 5015 5068 5088 5132
Synonym: ANKRD15; CPSQ2; KANK
XM_024447466.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 8, mRNA. (5230 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4642 4659 4679 4762 4834 4883 5001 5067 5120 5140 5184
Synonym: ANKRD15; CPSQ2; KANK
NM_001354334.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X14, mRNA. (5231 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4643 4660 4680 4763 4835 4884 5002 5068 5121 5141 5185
Synonym: ANKRD15; CPSQ2; KANK
XM_024447470.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X13, mRNA. (5466 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4877 4894 4914 4997 5069 5118 5236 5302 5355 5375 5419
Synonym: ANKRD15; CPSQ2; KANK
XM_017014525.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X11, mRNA. (5520 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4931 4948 4968 5051 5123 5172 5290 5356 5409 5429 5473
Synonym: ANKRD15; CPSQ2; KANK
XM_024447469.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X5, mRNA. (5528 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4940 4957 4977 5060 5132 5181 5299 5365 5418 5438 5482
Synonym: ANKRD15; CPSQ2; KANK
XM_024447464.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 3, mRNA. (5575 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 4987 5004 5024 5107 5179 5228 5346 5412 5465 5485 5529
Synonym: ANKRD15; CPSQ2; KANK
NM_001256876.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 4, mRNA. (5685 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 5097 5114 5134 5217 5289 5338 5456 5522 5575 5595 5639
Synonym: ANKRD15; CPSQ2; KANK
NM_001256877.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X10, mRNA. (5706 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 5117 5134 5154 5237 5309 5358 5476 5542 5595 5615 5659
Synonym: ANKRD15; CPSQ2; KANK
XM_017014517.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X4, mRNA. (5796 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 5208 5225 5245 5328 5400 5449 5567 5633 5686 5706 5750
Synonym: ANKRD15; CPSQ2; KANK
XM_024447463.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X16, misc_RNA. (5966 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 5377 5394 5414 5497 5569 5618 5736 5802 5855 5875 5919
Synonym: ANKRD15; CPSQ2; KANK
XR_002956771.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X2, mRNA. (6154 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 5566 5583 5603 5686 5758 5807 5925 5991 6044 6064 6108
Synonym: ANKRD15; CPSQ2; KANK
XM_024447461.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X3, mRNA. (6589 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 6001 6018 6038 6121 6193 6242 6360 6426 6479 6499 6543
Synonym: ANKRD15; CPSQ2; KANK
XM_024447462.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X1, mRNA. (6849 bp)
tcacagggaattctgatctgaaggggcaccttctgttcactcccacaaagtggtgtctggttctcactgagacgttttaagatttttccacaaatatttatatgtactaaatgtggaaccattagaaagttcttccaaaatctcattccagcatagttttggatttttcttttgtcttattttaaaataaggaagtcgagatgactttgatcattggtaacttgggcctgggccagacaaagtataaaacttacaaaagaatattctcatttggtcttaactaggtagatgtaatatatgactttttataaaaagggtatctatatgaacttgacacagtattttcagcttttgtattccatactaaagccatgaagaactacacgtaacatcatcatttgtattaattgcacaactccaatgctaaaggttggattgtgttagaggaatcggctctgtatttgcctctagagaaacacagtgttctctttgtatttatggattcctttttaccgtgtcacatttactttggtcctctatgtatttaaatgtttgaagtgccttagactcttgccatattttcaaaataaaattccatta...
position 6261 6278 6298 6381 6453 6502 6620 6686 6739 6759 6803
Synonym: ANKRD15; CPSQ2; KANK
XM_024447460.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/213005_s_at
lang : en | div : | spe : hs | query_string : 213005_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.084 | 0.084 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATGGATTCCTTTTTACCGTGTCA)?source=Homo sapiens (human)?to=0&format=json
0.097 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCACATTTACTTTGGTCCTCTAT)?source=Homo sapiens (human)?to=0&format=json
0.106 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTCACTCCCACAAAGTGGTGTCTG)?source=Homo sapiens (human)?to=0&format=json
0.118 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTGGTTCTCACTGAGACGTTTTA)?source=Homo sapiens (human)?to=0&format=json
0.129 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTTAGACTCTTGCCATATTTTCA)?source=Homo sapiens (human)?to=0&format=json
0.139 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATATTCTCATTTGGTCTTAACTA)?source=Homo sapiens (human)?to=0&format=json
0.149 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACTACACGTAACATCATCATTTG)?source=Homo sapiens (human)?to=0&format=json
0.160 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGAAGGGGCACCTTCTGTTCACTC)?source=Homo sapiens (human)?to=0&format=json
0.171 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCATTGGTAACTTGGGCCTGGGCC)?source=Homo sapiens (human)?to=0&format=json
0.182 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAGGAATCGGCTCTGTATTTGCCT)?source=Homo sapiens (human)?to=0&format=json
0.192 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAATCTCATTCCAGCATAGTTTTGG)?source=Homo sapiens (human)?to=0&format=json
1.164 | 0.973 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATGGATTCCTTTTTACCGTGTCA)%26(nt:TGTCACATTTACTTTGGTCCTCTAT)%26(nt:GTTCACTCCCACAAAGTGGTGTCTG)%26(nt:GTCTGGTTCTCACTGAGACGTTTTA)%26(nt:GCCTTAGACTCTTGCCATATTTTCA)%26(nt:GAATATTCTCATTTGGTCTTAACTA)%26(nt:GAACTACACGTAACATCATCATTTG)%26(nt:CTGAAGGGGCACCTTCTGTTCACTC)%26(nt:ATCATTGGTAACTTGGGCCTGGGCC)%26(nt:AGAGGAATCGGCTCTGTATTTGCCT)%26(nt:AAATCTCATTCCAGCATAGTTTTGG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
1.186 | 0.022 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]