GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-10-20 19:36:27, GGRNA : RefSeq release 90 (Sep, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X5, mRNA. (6935 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6354 6367 6426 6524 6585 6655 6740 6754 6859 6874 6889
Synonym: EIEE53; INPP5G; PARK20
XM_017028498.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X11, mRNA. (6959 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6378 6391 6450 6548 6609 6679 6764 6778 6883 6898 6913
Synonym: EIEE53; INPP5G; PARK20
XM_017028504.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X3, mRNA. (6974 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6393 6406 6465 6563 6624 6694 6779 6793 6898 6913 6928
Synonym: EIEE53; INPP5G; PARK20
XM_017028496.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X10, mRNA. (6998 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6417 6430 6489 6587 6648 6718 6803 6817 6922 6937 6952
Synonym: EIEE53; INPP5G; PARK20
XM_017028503.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X1, mRNA. (7013 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6432 6445 6504 6602 6663 6733 6818 6832 6937 6952 6967
Synonym: EIEE53; INPP5G; PARK20
XM_017028494.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X9, mRNA. (7034 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6453 6466 6525 6623 6684 6754 6839 6853 6958 6973 6988
Synonym: EIEE53; INPP5G; PARK20
XM_017028502.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X8, mRNA. (7082 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6501 6514 6573 6671 6732 6802 6887 6901 7006 7021 7036
Synonym: EIEE53; INPP5G; PARK20
XM_017028501.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X7, mRNA. (7085 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6504 6517 6576 6674 6735 6805 6890 6904 7009 7024 7039
Synonym: EIEE53; INPP5G; PARK20
XM_017028500.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens synaptojanin 1 (SYNJ1), transcript variant 4, mRNA. (6942 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6357 6370 6429 6527 6588 6658 6743 6757 6862 6877 6892
Synonym: EIEE53; INPP5G; PARK20
NM_001160306.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens synaptojanin 1 (SYNJ1), transcript variant 3, mRNA. (7059 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6474 6487 6546 6644 6705 6775 6860 6874 6979 6994 7009
Synonym: EIEE53; INPP5G; PARK20
NM_001160302.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens synaptojanin 1 (SYNJ1), transcript variant 1, mRNA. (7075 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6490 6503 6562 6660 6721 6791 6876 6890 6995 7010 7025
Synonym: EIEE53; INPP5G; PARK20
NM_003895.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens synaptojanin 1 (SYNJ1), transcript variant 2, mRNA. (7099 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 6514 6527 6586 6684 6745 6815 6900 6914 7019 7034 7049
Synonym: EIEE53; INPP5G; PARK20
NM_203446.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X6, mRNA. (10137 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 9556 9569 9628 9726 9787 9857 9942 9956 10061 10076 10091
Synonym: EIEE53; INPP5G; PARK20
XM_017028499.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X12, mRNA. (10161 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 9580 9593 9652 9750 9811 9881 9966 9980 10085 10100 10115
Synonym: EIEE53; INPP5G; PARK20
XM_017028505.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X4, mRNA. (10230 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 9649 9662 9721 9819 9880 9950 10035 10049 10154 10169 10184
Synonym: EIEE53; INPP5G; PARK20
XM_017028497.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens synaptojanin 1 (SYNJ1), transcript variant X2, mRNA. (10263 bp)
gtgctttttggaggttctaatcatttcagcagtagcgtcttaaacagcagtattactataagcagttgcttcaaaatgtgaattaacttgttgaaactgtggctttaacatccatgtgactagtgtatatggtatttgctctccattagcaaaataattcattgttaggtaaacttcactagtgcaaattgcagatctgtgagcaatgtttcctattgaatataaactactgtctaaaatatacatatcagcagcccagcctttatcaggaaaattatacttggcaagttgctgaaaatgcacaaagttatgaaagttaaaggtatgctgcaaataactagccattattctatgtattattaaatatttactagttctgttaaaagcagagcagaagttagacactaaggatctctttgtgaactctgtgttctctatattagattgctgtttatatgtaagaattttattgcttatgtggcatacaatatttataactataaactttatagaagtacagtattaaagtcagtggtacacagacattctgtacatatcctgtgaaacgtgctgtcatatgaaataaatatatctgtcttt...
position 9682 9695 9754 9852 9913 9983 10068 10082 10187 10202 10217
Synonym: EIEE53; INPP5G; PARK20
XM_017028495.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/212990_at
lang : en | div : | spe : hs | query_string : 212990_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCATTTCAGCAGTAGCGTCTTAAAC)?source=Homo sapiens (human)?to=0&format=json
0.095 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GGTATGCTGCAAATAACTAGCCATT)?source=Homo sapiens (human)?to=0&format=json
0.108 | 0.013 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCAGATCTGTGAGCAATGTTTCCTA)?source=Homo sapiens (human)?to=0&format=json
0.118 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAACTCTGTGTTCTCTATATTAGAT)?source=Homo sapiens (human)?to=0&format=json
0.127 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAAACTGTGGCTTTAACATCCATGT)?source=Homo sapiens (human)?to=0&format=json
0.137 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CAGCCCAGCCTTTATCAGGAAAATT)?source=Homo sapiens (human)?to=0&format=json
0.146 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ATCCTGTGAAACGTGCTGTCATATG)?source=Homo sapiens (human)?to=0&format=json
0.153 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGCGTCTTAAACAGCAGTATTACTA)?source=Homo sapiens (human)?to=0&format=json
0.161 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGACATTCTGTACATATCCTGTGAA)?source=Homo sapiens (human)?to=0&format=json
0.170 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAGTCAGTGGTACACAGACATTCTG)?source=Homo sapiens (human)?to=0&format=json
0.180 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAGGATCTCTTTGTGAACTCTGTGT)?source=Homo sapiens (human)?to=0&format=json
0.493 | 0.313 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCATTTCAGCAGTAGCGTCTTAAAC)%26(nt:GGTATGCTGCAAATAACTAGCCATT)%26(nt:GCAGATCTGTGAGCAATGTTTCCTA)%26(nt:GAACTCTGTGTTCTCTATATTAGAT)%26(nt:GAAACTGTGGCTTTAACATCCATGT)%26(nt:CAGCCCAGCCTTTATCAGGAAAATT)%26(nt:ATCCTGTGAAACGTGCTGTCATATG)%26(nt:AGCGTCTTAAACAGCAGTATTACTA)%26(nt:AGACATTCTGTACATATCCTGTGAA)%26(nt:AAGTCAGTGGTACACAGACATTCTG)%26(nt:AAGGATCTCTTTGTGAACTCTGTGT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.503 | 0.010 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]