GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-24 06:09:39, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ribosomal protein L13a (RPL13A), transcript variant 1, mRNA. (1127 bp)
ggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccgcaagcggatgaacaccaacccttcccgaggcccctaccacttccgggcccccagccgcatcttctggcggaccgtgcgaggtatgctgccccacaaaaccaagcgaggccaggccgctctggaccgtctcaaggtgtttgacggcatcccaccgccctacgacaagaaaaagcggatggtggttcctgctgccctcaaggtcgtgcgtctgaagcctacaagaaagtttgcctatctggggcgcctggctcacgaggttggctggaagtaccaggcagtgacagccaccctggaggagaagaggaaagagaaagccaagatccactaccggaagaagaaacagctcatgaggctacggaaacaggccgagaagaacgtggagaagaaaattgacaaatacacagaggtcctcaagacccacggactcctggtctgagcccaataaagactgttaattcct...
position 96 121 172 195 258 366 393 419 441 464 598
Synonym: L13A; TSTA1
NM_012423.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/212790_x_at
lang : en | div : | spe : hs | query_string : 212790_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTCTGGCGGACCGTGCGAGGTAT)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCGCAAGCGGATGAACACCAACCC)?source=Homo sapiens (human)?to=0&format=json
0.114 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAAGGTCGTGCGTCTGAAGCCTAC)?source=Homo sapiens (human)?to=0&format=json
0.124 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGGTCGTACGCTGTGAAGGCATC)?source=Homo sapiens (human)?to=0&format=json
0.134 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTGGCTCACGAGGTTGGCTGGAA)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACAGAGGTCCTCAAGACCCACGGA)?source=Homo sapiens (human)?to=0&format=json
0.156 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAAGTTGAAGTACCTGGCTTTCCTC)?source=Homo sapiens (human)?to=0&format=json
0.167 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAAAGTTTGCCTATCTGGGGCGCC)?source=Homo sapiens (human)?to=0&format=json
0.177 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTACCAGGCAGTGACAGCCACCC)?source=Homo sapiens (human)?to=0&format=json
0.425 | 0.247 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACAGGTACTGCTGGGCCGGAAGGT)?source=Homo sapiens (human)?to=0&format=json
0.436 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAAGCGGATGGTGGTTCCTGCTGC)?source=Homo sapiens (human)?to=0&format=json
0.461 | 0.026 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTCTGGCGGACCGTGCGAGGTAT)%26(nt:TCCGCAAGCGGATGAACACCAACCC)%26(nt:TCAAGGTCGTGCGTCTGAAGCCTAC)%26(nt:GGTGGTCGTACGCTGTGAAGGCATC)%26(nt:GCCTGGCTCACGAGGTTGGCTGGAA)%26(nt:CACAGAGGTCCTCAAGACCCACGGA)%26(nt:CAAGTTGAAGTACCTGGCTTTCCTC)%26(nt:AGAAAGTTTGCCTATCTGGGGCGCC)%26(nt:AAGTACCAGGCAGTGACAGCCACCC)%26(nt:AACAGGTACTGCTGGGCCGGAAGGT)%26(nt:AAAAGCGGATGGTGGTTCCTGCTGC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.462 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]