GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:44:42, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X13, mRNA. (4340 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3255 3393 3403 3439 3478 3494 3533 3558 3595 3689 3728
Synonym: NDR2
XM_011520613.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X11, mRNA. (4401 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3316 3454 3464 3500 3539 3555 3594 3619 3656 3750 3789
Synonym: NDR2
XM_005253342.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X6, mRNA. (4557 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3472 3610 3620 3656 3695 3711 3750 3775 3812 3906 3945
Synonym: NDR2
XM_024448894.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X9, mRNA. (4593 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3508 3646 3656 3692 3731 3747 3786 3811 3848 3942 3981
Synonym: NDR2
XM_024448896.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X12, mRNA. (4606 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3521 3659 3669 3705 3744 3760 3799 3824 3861 3955 3994
Synonym: NDR2
XM_006719059.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X8, mRNA. (4627 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3542 3680 3690 3726 3765 3781 3820 3845 3882 3976 4015
Synonym: NDR2
XM_006719058.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X14, misc_RNA. (4643 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3270 3408 3418 3454 3493 3509 3548 3573 3610 3704 3743
Synonym: NDR2
XR_001748626.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X7, mRNA. (4673 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3588 3726 3736 3772 3811 3827 3866 3891 3928 4022 4061
Synonym: NDR2
XM_024448895.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X10, mRNA. (4685 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3600 3738 3748 3784 3823 3839 3878 3903 3940 4034 4073
Synonym: NDR2
XM_024448897.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens serine/threonine kinase 38 like (STK38L), mRNA. (4957 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3420 3558 3568 3604 3643 3659 3698 3723 3760 3854 3893
Synonym: NDR2
NM_015000.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X1, mRNA. (4995 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3622 3760 3770 3806 3845 3861 3900 3925 3962 4056 4095
Synonym: NDR2
XM_024448889.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X2, mRNA. (5021 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3648 3786 3796 3832 3871 3887 3926 3951 3988 4082 4121
Synonym: NDR2
XM_024448890.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X4, mRNA. (5061 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3688 3826 3836 3872 3911 3927 3966 3991 4028 4122 4161
Synonym: NDR2
XM_024448892.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X3, mRNA. (5086 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 3713 3851 3861 3897 3936 3952 3991 4016 4053 4147 4186
Synonym: NDR2
XM_024448891.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X5, mRNA. (5458 bp)
taaaaaggactgttttgctagtgtgataatgaataggtaagatatgagataattgcaacattgtctagttctagtatggtaactattcttgaaatggtattgaaaaataccgttaattcaaattgacagagattgataaaaagaaactgatttacctaagtttactttttaattgcataatagagcattttttgttttgagttccctcattcttattaccagaaagagcttgcaaatagttttactttcttggcactggaagggtagttctggaaagctactttgttgagagtctcattcttccctggagttaatagagtgattcacaatctttggggttttctcctcatcaaaagcatttcttaagtgcctatctaaaagcaattaaagactgtgtctgccctttagaagctaagaatttgattcatgatgcaaattaactagataatttgcaaagtacccttgagattgaattttctctattatatatttcccatatttcaggtgaataatttaatttaaatgacaaaaccctatctagtcaactgggcataatgacattttctttaaattagactctattttgaattaaaagagttt...
position 4085 4223 4233 4269 4308 4324 4363 4388 4425 4519 4558
Synonym: NDR2
XM_024448893.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/212572_at
lang : en | div : | spe : hs | query_string : 212572_at | format : html | download :

0.000 | 0.000 | search_start;
0.095 | 0.095 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTTGTTTTGAGTTCCCTCATTCTT)?source=Homo sapiens (human)?to=0&format=json
0.106 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTTGGGGTTTTCTCCTCATCAAA)?source=Homo sapiens (human)?to=0&format=json
0.117 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATATTTCCCATATTTCAGGTGAAT)?source=Homo sapiens (human)?to=0&format=json
0.127 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACAAAACCCTATCTAGTCAACTGG)?source=Homo sapiens (human)?to=0&format=json
0.137 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGTGTCTGCCCTTTAGAAGCTAAG)?source=Homo sapiens (human)?to=0&format=json
0.147 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTGCAACATTGTCTAGTTCTAGTA)?source=Homo sapiens (human)?to=0&format=json
0.157 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATAGTTTTACTTTCTTGGCACTGGA)?source=Homo sapiens (human)?to=0&format=json
0.168 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTTCCCTCATTCTTATTACCAGAA)?source=Homo sapiens (human)?to=0&format=json
0.178 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTCTCATTCTTCCCTGGAGTTAAT)?source=Homo sapiens (human)?to=0&format=json
0.204 | 0.026 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCATTTCTTAAGTGCCTATCTAAA)?source=Homo sapiens (human)?to=0&format=json
0.214 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGCTACTTTGTTGAGAGTCTCATT)?source=Homo sapiens (human)?to=0&format=json
0.571 | 0.357 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTTGTTTTGAGTTCCCTCATTCTT)%26(nt:TCTTTGGGGTTTTCTCCTCATCAAA)%26(nt:TATATTTCCCATATTTCAGGTGAAT)%26(nt:GACAAAACCCTATCTAGTCAACTGG)%26(nt:CTGTGTCTGCCCTTTAGAAGCTAAG)%26(nt:ATTGCAACATTGTCTAGTTCTAGTA)%26(nt:ATAGTTTTACTTTCTTGGCACTGGA)%26(nt:AGTTCCCTCATTCTTATTACCAGAA)%26(nt:AGTCTCATTCTTCCCTGGAGTTAAT)%26(nt:AGCATTTCTTAAGTGCCTATCTAAA)%26(nt:AAGCTACTTTGTTGAGAGTCTCATT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.580 | 0.009 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]