GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:22:32, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X9, mRNA. (10398 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 7577 7590 7603 7683 7802 7817 7880 7914 8001 8074 8126
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_005248697.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X10, mRNA. (10404 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 7583 7596 7609 7689 7808 7823 7886 7920 8007 8080 8132
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_011535625.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X5, mRNA. (10730 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 7909 7922 7935 8015 8134 8149 8212 8246 8333 8406 8458
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010580.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X7, mRNA. (11023 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 8202 8215 8228 8308 8427 8442 8505 8539 8626 8699 8751
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010583.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X1, mRNA. (11301 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 8480 8493 8506 8586 8705 8720 8783 8817 8904 8977 9029
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010576.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger protein 292 (ZNF292), transcript variant 1, mRNA. (12341 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 7749 7762 7775 7855 7974 7989 8052 8086 8173 8246 8298
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
NM_015021.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens zinc finger protein 292 (ZNF292), transcript variant 2, mRNA. (12486 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 7894 7907 7920 8000 8119 8134 8197 8231 8318 8391 8443
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
NM_001351444.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X4, mRNA. (13309 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 10488 10501 10514 10594 10713 10728 10791 10825 10912 10985 11037
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010579.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X6, mRNA. (13426 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 10605 10618 10631 10711 10830 10845 10908 10942 11029 11102 11154
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010582.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X2, mRNA. (13630 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 10809 10822 10835 10915 11034 11049 11112 11146 11233 11306 11358
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010577.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X8, mRNA. (16263 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 13442 13455 13468 13548 13667 13682 13745 13779 13866 13939 13991
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010584.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X3, mRNA. (17147 bp)
ccattcaaaccattgaggagcatcctgcatcttttgactggagctcttttaagccaatgggatttgaagtatcatttctgaagtttcttgaggagtctgcagtgaagcagaagaaaaatactgacaaagaccatccgaatactggaaacaaaaaaggatcccattcaaattcaagaaaaaatattgataagactgctgtgactagtggaaatcatgtatgtccttgtaaagaaagcgaaacgtttgtacagtttgccaatccatcacagcttcagtgcagtgataatgtaaaaattgttttagacaagaatcttaaagattgcactgagcttgtcttaaagcaacttcaggaaatgaaacctaccgtcagtctgaaaaaacttgaagtacattcaaatgatccagatatgtctgttatgaaagatatcagtataggtaaagccacaggcagaggtcagtactgataattaatgtagtataaatacatcatttaccattttattttaaataggaagccatcaagcatgctagaattgtgaaactttcattatatttttttgttgttgacatgaattaacctggccaaaaacaaaaaagaaa...
position 14326 14339 14352 14432 14551 14566 14629 14663 14750 14823 14875
Synonym: bA393I2.3; Nbla00365; ZFP292; Zn-15; ZN-16
XM_017010578.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/212368_at
lang : en | div : | spe : hs | query_string : 212368_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCAATCCATCACAGCTTCAGTGC)?source=Homo sapiens (human)?to=0&format=json
0.101 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAGGAGCATCCTGCATCTTTTGAC)?source=Homo sapiens (human)?to=0&format=json
0.113 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGACATGAATTAACCTGGCCAAA)?source=Homo sapiens (human)?to=0&format=json
0.126 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGCTCTTTTAAGCCAATGGGATT)?source=Homo sapiens (human)?to=0&format=json
0.137 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAAGCCATCAAGCATGCTAGAATT)?source=Homo sapiens (human)?to=0&format=json
0.149 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCATCTTTTGACTGGAGCTCTTTTA)?source=Homo sapiens (human)?to=0&format=json
0.160 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAATGAAACCTACCGTCAGTCTGA)?source=Homo sapiens (human)?to=0&format=json
0.170 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATTGCACTGAGCTTGTCTTAAAG)?source=Homo sapiens (human)?to=0&format=json
0.179 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTGACAAAGACCATCCGAATACTG)?source=Homo sapiens (human)?to=0&format=json
0.188 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACGTTTGTACAGTTTGCCAATCCA)?source=Homo sapiens (human)?to=0&format=json
0.200 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGCCACAGGCAGAGGTCAGTACT)?source=Homo sapiens (human)?to=0&format=json
0.965 | 0.765 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCAATCCATCACAGCTTCAGTGC)%26(nt:TGAGGAGCATCCTGCATCTTTTGAC)%26(nt:GTTGACATGAATTAACCTGGCCAAA)%26(nt:GGAGCTCTTTTAAGCCAATGGGATT)%26(nt:GGAAGCCATCAAGCATGCTAGAATT)%26(nt:GCATCTTTTGACTGGAGCTCTTTTA)%26(nt:GAAATGAAACCTACCGTCAGTCTGA)%26(nt:AGATTGCACTGAGCTTGTCTTAAAG)%26(nt:ACTGACAAAGACCATCCGAATACTG)%26(nt:AACGTTTGTACAGTTTGCCAATCCA)%26(nt:AAAGCCACAGGCAGAGGTCAGTACT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.973 | 0.008 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]