GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2020-12-05 23:35:24, GGRNA : RefSeq release 202 (Sep, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens microtubule associated protein 1B (MAP1B), transcript variant 2, mRNA. (11568 bp)
ttttttgtgcttcagatttagaagaaaagatcctgtttccatttgaaaggaactgtaagcttttatcttttaaccaactgaacaatacaccaaaagcagcctagggatgagcatttctttgaaagcaattaggttattcacctggtattaaaactatttactgttaaaaaatctgtgacttcatgaagttgatttttaaaggcagcatcaaaaactgaaaaggaagggaaaaaataggcagcttctctgcacttgtttggagctccccaaaacaggagccatggagaagtggcatcaagaccgggctgccctttcgagaacaccctgtggcagttcagagacacgcttttcctacactgcatgcagcccctctttccagcactggaaagaagtggtcttgagcccagctgagaagcacttcacactcctctctcttgttctgaatggtgtttgtgtcagtctgcagctgtgtatggtattatgtcttataatcctgcatcacttctatcctatccagtcatatctaatgtagaaaattagtttccagtgaaagtaatatgtagtgcttttatgatatttgtgtgcaatatcccctcttcc...
position 10994 11141 11159 11227 11265 11292 11306 11349 11363 11383 11399
Synonym: FUTSCH; MAP5; PPP1R102; PVNH9
NM_001324255.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens microtubule associated protein 1B (MAP1B), transcript variant 1, mRNA. (11790 bp)
ttttttgtgcttcagatttagaagaaaagatcctgtttccatttgaaaggaactgtaagcttttatcttttaaccaactgaacaatacaccaaaagcagcctagggatgagcatttctttgaaagcaattaggttattcacctggtattaaaactatttactgttaaaaaatctgtgacttcatgaagttgatttttaaaggcagcatcaaaaactgaaaaggaagggaaaaaataggcagcttctctgcacttgtttggagctccccaaaacaggagccatggagaagtggcatcaagaccgggctgccctttcgagaacaccctgtggcagttcagagacacgcttttcctacactgcatgcagcccctctttccagcactggaaagaagtggtcttgagcccagctgagaagcacttcacactcctctctcttgttctgaatggtgtttgtgtcagtctgcagctgtgtatggtattatgtcttataatcctgcatcacttctatcctatccagtcatatctaatgtagaaaattagtttccagtgaaagtaatatgtagtgcttttatgatatttgtgtgcaatatcccctcttcc...
position 11216 11363 11381 11449 11487 11514 11528 11571 11585 11605 11621
Synonym: FUTSCH; MAP5; PPP1R102; PVNH9
NM_005909.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/212233_at
lang : en | div : | spe : hs | query_string : 212233_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCACTTCTATCCTATCCAGTCATAT)?source=Homo sapiens (human)?to=0&format=json
0.098 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTTTGTGTCAGTCTGCAGCTGTGTA)?source=Homo sapiens (human)?to=0&format=json
0.108 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTGGTCTTGAGCCCAGCTGAGAAGC)?source=Homo sapiens (human)?to=0&format=json
0.118 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTGGCAGTTCAGAGACACGCTTTTC)?source=Homo sapiens (human)?to=0&format=json
0.127 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTCTTATAATCCTGCATCACTTCTA)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GGAGCTCCCCAAAACAGGAGCCATG)?source=Homo sapiens (human)?to=0&format=json
0.144 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCTTCTCTGCACTTGTTTGGAGCTC)?source=Homo sapiens (human)?to=0&format=json
0.153 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCAGCTGTGTATGGTATTATGTCTT)?source=Homo sapiens (human)?to=0&format=json
0.163 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGCTGAGAAGCACTTCACACTCCTC)?source=Homo sapiens (human)?to=0&format=json
0.171 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGCCCCTCTTTCCAGCACTGGAAAG)?source=Homo sapiens (human)?to=0&format=json
0.181 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAGCAGCCTAGGGATGAGCATTTCT)?source=Homo sapiens (human)?to=0&format=json
0.299 | 0.118 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCACTTCTATCCTATCCAGTCATAT)%26(nt:GTTTGTGTCAGTCTGCAGCTGTGTA)%26(nt:GTGGTCTTGAGCCCAGCTGAGAAGC)%26(nt:GTGGCAGTTCAGAGACACGCTTTTC)%26(nt:GTCTTATAATCCTGCATCACTTCTA)%26(nt:GGAGCTCCCCAAAACAGGAGCCATG)%26(nt:GCTTCTCTGCACTTGTTTGGAGCTC)%26(nt:GCAGCTGTGTATGGTATTATGTCTT)%26(nt:AGCTGAGAAGCACTTCACACTCCTC)%26(nt:AGCCCCTCTTTCCAGCACTGGAAAG)%26(nt:AAGCAGCCTAGGGATGAGCATTTCT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.300 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]