GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:01:53, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens F-box protein 21 (FBXO21), transcript variant X2, mRNA. (4014 bp)
gcagttactagaaagagatggggatttggcccctggctcctccagcctgaatgagctatttaatccactgtccatgttcctcatcagtcaaatccaaagtcaaaggatttgaacctgcatctggaaacgtaaccactcacagcacctggcccgccaaggttgggaggattgtacactactttcatttaaaggggaaagtttgataatacggaattaattaatatgaatgagatgcattaataagaacctgagcatgctgagagttgcaattgttggttttctggtttgattgatttccttttttcttagacacatcaaagtcaagaaagatggttttacctttactgacccagctgtacatatgtatctagactgtttttaaatgtctttcttcatgaatgcttcatggggctccaggaagcctgtatcacctgtgtaagttggtatttgggcactttatatttttctaaaaacgtgttttggatcctgtactctaataaatcataagtttctttttaaaaattttccaaaacttttctccattttaaaaagccctgttataaacgttgaactttcacaatgttaaaatgttaaatattt...
position 3427 3444 3468 3484 3583 3597 3651 3659 3718 3734 3794
Synonym: FBX21
XM_017019038.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens F-box protein 21 (FBXO21), transcript variant X3, mRNA. (4121 bp)
gcagttactagaaagagatggggatttggcccctggctcctccagcctgaatgagctatttaatccactgtccatgttcctcatcagtcaaatccaaagtcaaaggatttgaacctgcatctggaaacgtaaccactcacagcacctggcccgccaaggttgggaggattgtacactactttcatttaaaggggaaagtttgataatacggaattaattaatatgaatgagatgcattaataagaacctgagcatgctgagagttgcaattgttggttttctggtttgattgatttccttttttcttagacacatcaaagtcaagaaagatggttttacctttactgacccagctgtacatatgtatctagactgtttttaaatgtctttcttcatgaatgcttcatggggctccaggaagcctgtatcacctgtgtaagttggtatttgggcactttatatttttctaaaaacgtgttttggatcctgtactctaataaatcataagtttctttttaaaaattttccaaaacttttctccattttaaaaagccctgttataaacgttgaactttcacaatgttaaaatgttaaatattt...
position 3247 3264 3288 3304 3403 3417 3471 3479 3538 3554 3614
Synonym: FBX21
XM_017019039.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens F-box protein 21 (FBXO21), transcript variant X1, mRNA. (4336 bp)
gcagttactagaaagagatggggatttggcccctggctcctccagcctgaatgagctatttaatccactgtccatgttcctcatcagtcaaatccaaagtcaaaggatttgaacctgcatctggaaacgtaaccactcacagcacctggcccgccaaggttgggaggattgtacactactttcatttaaaggggaaagtttgataatacggaattaattaatatgaatgagatgcattaataagaacctgagcatgctgagagttgcaattgttggttttctggtttgattgatttccttttttcttagacacatcaaagtcaagaaagatggttttacctttactgacccagctgtacatatgtatctagactgtttttaaatgtctttcttcatgaatgcttcatggggctccaggaagcctgtatcacctgtgtaagttggtatttgggcactttatatttttctaaaaacgtgttttggatcctgtactctaataaatcataagtttctttttaaaaattttccaaaacttttctccattttaaaaagccctgttataaacgttgaactttcacaatgttaaaatgttaaatattt...
position 3448 3465 3489 3505 3604 3618 3672 3680 3739 3755 3815
Synonym: FBX21
XM_017019037.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens F-box protein 21 (FBXO21), transcript variant 2, mRNA. (5976 bp)
gcagttactagaaagagatggggatttggcccctggctcctccagcctgaatgagctatttaatccactgtccatgttcctcatcagtcaaatccaaagtcaaaggatttgaacctgcatctggaaacgtaaccactcacagcacctggcccgccaaggttgggaggattgtacactactttcatttaaaggggaaagtttgataatacggaattaattaatatgaatgagatgcattaataagaacctgagcatgctgagagttgcaattgttggttttctggtttgattgatttccttttttcttagacacatcaaagtcaagaaagatggttttacctttactgacccagctgtacatatgtatctagactgtttttaaatgtctttcttcatgaatgcttcatggggctccaggaagcctgtatcacctgtgtaagttggtatttgggcactttatatttttctaaaaacgtgttttggatcctgtactctaataaatcataagtttctttttaaaaattttccaaaacttttctccattttaaaaagccctgttataaacgttgaactttcacaatgttaaaatgttaaatattt...
position 3606 3623 3647 3663 3762 3776 3830 3838 3897 3913 3973
Synonym: FBX21
NM_015002.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens F-box protein 21 (FBXO21), transcript variant 1, mRNA. (5997 bp)
gcagttactagaaagagatggggatttggcccctggctcctccagcctgaatgagctatttaatccactgtccatgttcctcatcagtcaaatccaaagtcaaaggatttgaacctgcatctggaaacgtaaccactcacagcacctggcccgccaaggttgggaggattgtacactactttcatttaaaggggaaagtttgataatacggaattaattaatatgaatgagatgcattaataagaacctgagcatgctgagagttgcaattgttggttttctggtttgattgatttccttttttcttagacacatcaaagtcaagaaagatggttttacctttactgacccagctgtacatatgtatctagactgtttttaaatgtctttcttcatgaatgcttcatggggctccaggaagcctgtatcacctgtgtaagttggtatttgggcactttatatttttctaaaaacgtgttttggatcctgtactctaataaatcataagtttctttttaaaaattttccaaaacttttctccattttaaaaagccctgttataaacgttgaactttcacaatgttaaaatgttaaatattt...
position 3627 3644 3668 3684 3783 3797 3851 3859 3918 3934 3994
Synonym: FBX21
NM_033624.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/212231_at
lang : en | div : | spe : hs | query_string : 212231_at | format : html | download :

0.000 | 0.000 | search_start;
0.365 | 0.365 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGAAACGTAACCACTCACAGCACC)?source=Homo sapiens (human)?to=0&format=json
0.380 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAATGCTTCATGGGGCTCCAGGAA)?source=Homo sapiens (human)?to=0&format=json
0.390 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACCTTTACTGACCCAGCTGTACAT)?source=Homo sapiens (human)?to=0&format=json
0.402 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTTTTCTGGTTTGATTGATTTCCT)?source=Homo sapiens (human)?to=0&format=json
0.412 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGAGGATTGTACACTACTTTCATT)?source=Homo sapiens (human)?to=0&format=json
0.421 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGATTTGAACCTGCATCTGGAAACG)?source=Homo sapiens (human)?to=0&format=json
0.431 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATGGTTTTACCTTTACTGACCCAG)?source=Homo sapiens (human)?to=0&format=json
0.441 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGTTGCAATTGTTGGTTTTCTGGT)?source=Homo sapiens (human)?to=0&format=json
0.451 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGCCCGCCAAGGTTGGGAGGATT)?source=Homo sapiens (human)?to=0&format=json
0.462 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCCAGGAAGCCTGTATCACCTGTG)?source=Homo sapiens (human)?to=0&format=json
0.473 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACGTGTTTTGGATCCTGTACTCTA)?source=Homo sapiens (human)?to=0&format=json
0.582 | 0.110 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGAAACGTAACCACTCACAGCACC)%26(nt:TGAATGCTTCATGGGGCTCCAGGAA)%26(nt:TACCTTTACTGACCCAGCTGTACAT)%26(nt:GGTTTTCTGGTTTGATTGATTTCCT)%26(nt:GGGAGGATTGTACACTACTTTCATT)%26(nt:GGATTTGAACCTGCATCTGGAAACG)%26(nt:GATGGTTTTACCTTTACTGACCCAG)%26(nt:GAGTTGCAATTGTTGGTTTTCTGGT)%26(nt:CTGGCCCGCCAAGGTTGGGAGGATT)%26(nt:CTCCAGGAAGCCTGTATCACCTGTG)%26(nt:AACGTGTTTTGGATCCTGTACTCTA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.586 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]