GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:32:47, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens ZFP36 ring finger protein like 1 (ZFP36L1), transcript variant 2, mRNA. (2649 bp)
tatctgtgtaaaacgatttcctgtagaagtagctttaatggtttttgctctagaataccgtaggtctatccttagagcactcacgccatgctttcttccctgggttttaaacttcatataactttcagaaattggagagcaaaaattttgcttgtcactgcacatcaatataaaaaagcttatttaacttatcaaaacgtatttattgccaaactatgcttttttttgttaattttgttcatatttatcgggatgacaaatccatagaatatattcttttatgttaaattatgatcttcatattaatcttaaaattttgtgacgtgtctttttcctttttttccacagttttaatatattattcttcaacgacattttttgtaactttacacttttttggttattttattttaaaaaaatgaaaaattaatttaaaaaaatgcaaaaaactgttggattatttattttagaaattcccccctttgtgttggactgcaaattgagtttctttctctttaggcctttcacaactaggactgagaatgtatgtaaaagttctgtgacagtacagaaggaaaacaactttttatgtatagcttc...
position 1790 1796 1865 2112 2235 2248 2267 2271 2277 2286 2303
Synonym: Berg36; BRF1; cMG1; ERF-1; ERF1; RNF162B; TIS11B
NM_001244698.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ZFP36 ring finger protein like 1 (ZFP36L1), transcript variant 1, mRNA. (3017 bp)
tatctgtgtaaaacgatttcctgtagaagtagctttaatggtttttgctctagaataccgtaggtctatccttagagcactcacgccatgctttcttccctgggttttaaacttcatataactttcagaaattggagagcaaaaattttgcttgtcactgcacatcaatataaaaaagcttatttaacttatcaaaacgtatttattgccaaactatgcttttttttgttaattttgttcatatttatcgggatgacaaatccatagaatatattcttttatgttaaattatgatcttcatattaatcttaaaattttgtgacgtgtctttttcctttttttccacagttttaatatattattcttcaacgacattttttgtaactttacacttttttggttattttattttaaaaaaatgaaaaattaatttaaaaaaatgcaaaaaactgttggattatttattttagaaattcccccctttgtgttggactgcaaattgagtttctttctctttaggcctttcacaactaggactgagaatgtatgtaaaagttctgtgacagtacagaaggaaaacaactttttatgtatagcttc...
position 2158 2164 2233 2480 2603 2616 2635 2639 2645 2654 2671
Synonym: Berg36; BRF1; cMG1; ERF-1; ERF1; RNF162B; TIS11B
NM_004926.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens ZFP36 ring finger protein like 1 (ZFP36L1), transcript variant 3, mRNA. (3212 bp)
tatctgtgtaaaacgatttcctgtagaagtagctttaatggtttttgctctagaataccgtaggtctatccttagagcactcacgccatgctttcttccctgggttttaaacttcatataactttcagaaattggagagcaaaaattttgcttgtcactgcacatcaatataaaaaagcttatttaacttatcaaaacgtatttattgccaaactatgcttttttttgttaattttgttcatatttatcgggatgacaaatccatagaatatattcttttatgttaaattatgatcttcatattaatcttaaaattttgtgacgtgtctttttcctttttttccacagttttaatatattattcttcaacgacattttttgtaactttacacttttttggttattttattttaaaaaaatgaaaaattaatttaaaaaaatgcaaaaaactgttggattatttattttagaaattcccccctttgtgttggactgcaaattgagtttctttctctttaggcctttcacaactaggactgagaatgtatgtaaaagttctgtgacagtacagaaggaaaacaactttttatgtatagcttc...
position 2330 2336 2405 2652 2775 2788 2807 2811 2817 2826 2843
Synonym: Berg36; BRF1; cMG1; ERF-1; ERF1; RNF162B; TIS11B
NM_001244701.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/211962_s_at
lang : en | div : | spe : hs | query_string : 211962_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCTCTTTAGGCCTTTCACAACTA)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTAAACTTCATATAACTTTCAGAAA)?source=Homo sapiens (human)?to=0&format=json
0.114 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTTAGGCCTTTCACAACTAGGAC)?source=Homo sapiens (human)?to=0&format=json
0.131 | 0.017 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATGTAAAAGTTCTGTGACAGTAC)?source=Homo sapiens (human)?to=0&format=json
0.141 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCCTTTCACAACTAGGACTGAGAA)?source=Homo sapiens (human)?to=0&format=json
0.151 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACTGCAAATTGAGTTTCTTTCTC)?source=Homo sapiens (human)?to=0&format=json
0.161 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTTTAATGGTTTTTGCTCTAGAAT)?source=Homo sapiens (human)?to=0&format=json
0.171 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCCCTTTGTGTTGGACTGCAAATT)?source=Homo sapiens (human)?to=0&format=json
0.181 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAACTAGGACTGAGAATGTATGTAA)?source=Homo sapiens (human)?to=0&format=json
0.208 | 0.027 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGGTTTTTGCTCTAGAATACCGTA)?source=Homo sapiens (human)?to=0&format=json
0.220 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATATATTATTCTTCAACGACATTTT)?source=Homo sapiens (human)?to=0&format=json
0.289 | 0.068 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCTCTTTAGGCCTTTCACAACTA)%26(nt:TTAAACTTCATATAACTTTCAGAAA)%26(nt:TCTTTAGGCCTTTCACAACTAGGAC)%26(nt:GTATGTAAAAGTTCTGTGACAGTAC)%26(nt:GGCCTTTCACAACTAGGACTGAGAA)%26(nt:GGACTGCAAATTGAGTTTCTTTCTC)%26(nt:GCTTTAATGGTTTTTGCTCTAGAAT)%26(nt:CCCCCTTTGTGTTGGACTGCAAATT)%26(nt:CAACTAGGACTGAGAATGTATGTAA)%26(nt:ATGGTTTTTGCTCTAGAATACCGTA)%26(nt:ATATATTATTCTTCAACGACATTTT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.291 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]