GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:54:37, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 5, mRNA. (1380 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 746 786 801 816 908 948 1023 1068 1110 1123 1164
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_001007250.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 4, mRNA. (1501 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 867 907 922 937 1029 1069 1144 1189 1231 1244 1285
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_001007100.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 3, mRNA. (1510 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 876 916 931 946 1038 1078 1153 1198 1240 1253 1294
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_001007099.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens sterol carrier protein 2 (SCP2), transcript variant X1, mRNA. (2532 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 1985 2025 2040 2055 2147 2187 2262 2307 2349 2362 2403
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
XM_005271103.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 6, mRNA. (2627 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 1993 2033 2048 2063 2155 2195 2270 2315 2357 2370 2411
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_001193600.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 7, mRNA. (2687 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 2053 2093 2108 2123 2215 2255 2330 2375 2417 2430 2471
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_001193599.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 8, mRNA. (2701 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 2067 2107 2122 2137 2229 2269 2344 2389 2431 2444 2485
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_001193617.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 1, mRNA. (2759 bp)
cagtaaaatccaaagaactatgtaaacaaaaaagcttttgttttgcttacaaagtatatttaaggattattctgctgaagattcagtttaagagttttccttgggagaactaagtaagaaacacaatgccaacagctggccagtaattagtgttgtgcacttcatgtcattaatcaatttctcaatagttcttaaaattagtgagattaaaaatctaaaaattttgcatttcatgctatcagaaacagtattttcttcccaaatcaaaataaaagaaatatgatcagagcttgaacacaggcttatttttaaaataaaaatatttttaacatgggtttccttattgaaaaatcagtgtattagtcataaaacaccatcattaagaataattgaacaataaagtttgctttcagatgcagttttcaaattataatctcatttcaatttataacgttctcagtcctttgttataattttcctttttcatgtaagtttaattatctgcatttatcttttttcctagtttttctaatactaatgttatttcttaaaattcagtgagatataggataaaataatgctttgagaagaatgtttaat...
position 2125 2165 2180 2195 2287 2327 2402 2447 2489 2502 2543
Synonym: NLTP; NSL-TP; SCP-2; SCP-CHI; SCP-X; SCPX
NM_002979.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/211733_x_at
lang : en | div : | spe : hs | query_string : 211733_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.082 | 0.082 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATCTGCATTTATCTTTTTTCCTA)?source=Homo sapiens (human)?to=0&format=json
0.090 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAGTCCTTTGTTATAATTTTCCTT)?source=Homo sapiens (human)?to=0&format=json
0.097 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTGCTTTCAGATGCAGTTTTCAA)?source=Homo sapiens (human)?to=0&format=json
0.104 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGTTGTGCACTTCATGTCATTAAT)?source=Homo sapiens (human)?to=0&format=json
0.111 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATTAGTCATAAAACACCATCATT)?source=Homo sapiens (human)?to=0&format=json
0.119 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGGCCAGTAATTAGTGTTGTGCA)?source=Homo sapiens (human)?to=0&format=json
0.126 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATTCAGTTTAAGAGTTTTCCTTGG)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCAGAGCTTGAACACAGGCTTAT)?source=Homo sapiens (human)?to=0&format=json
0.140 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAACAGTATTTTCTTCCCAAATCA)?source=Homo sapiens (human)?to=0&format=json
0.147 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTATAACGTTCTCAGTCCTTTGT)?source=Homo sapiens (human)?to=0&format=json
0.154 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACACAATGCCAACAGCTGGCCAGT)?source=Homo sapiens (human)?to=0&format=json
0.308 | 0.154 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATCTGCATTTATCTTTTTTCCTA)%26(nt:TCAGTCCTTTGTTATAATTTTCCTT)%26(nt:GTTTGCTTTCAGATGCAGTTTTCAA)%26(nt:GTGTTGTGCACTTCATGTCATTAAT)%26(nt:GTATTAGTCATAAAACACCATCATT)%26(nt:GCTGGCCAGTAATTAGTGTTGTGCA)%26(nt:GATTCAGTTTAAGAGTTTTCCTTGG)%26(nt:GATCAGAGCTTGAACACAGGCTTAT)%26(nt:GAAACAGTATTTTCTTCCCAAATCA)%26(nt:ATTTATAACGTTCTCAGTCCTTTGT)%26(nt:AACACAATGCCAACAGCTGGCCAGT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.313 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]