GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2020-12-05 23:48:46, GGRNA : RefSeq release 202 (Sep, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant X5, mRNA. (4770 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4042 4062 4078 4104 4210 4281 4330 4411 4498 4511 4548
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
XM_016999995.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant 4, mRNA. (5564 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4838 4858 4874 4900 5006 5077 5126 5207 5294 5307 5344
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
NM_001195001.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant 1, mRNA. (5573 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4847 4867 4883 4909 5015 5086 5135 5216 5303 5316 5353
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
NM_133178.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant X4, mRNA. (5574 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4846 4866 4882 4908 5014 5085 5134 5215 5302 5315 5352
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
XM_006710269.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant X3, mRNA. (5577 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4849 4869 4885 4911 5017 5088 5137 5218 5305 5318 5355
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
XM_016999994.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant 2, mRNA. (5585 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4859 4879 4895 4921 5027 5098 5147 5228 5315 5328 5365
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
NM_133177.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant X2, mRNA. (5595 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4867 4887 4903 4929 5035 5106 5155 5236 5323 5336 5373
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
XM_016999993.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant 3, mRNA. (5603 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4877 4897 4913 4939 5045 5116 5165 5246 5333 5346 5383
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
NM_005704.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant X1, mRNA. (5604 bp)
agagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaa...
position 4876 4896 4912 4938 5044 5115 5164 5245 5332 5345 5382
Synonym: FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U
XM_016999992.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/211320_s_at
lang : en | div : | spe : hs | query_string : 211320_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.082 | 0.082 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTGGCATTTAGGATTCCATCTGGCC)?source=Homo sapiens (human)?to=0&format=json
0.089 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCCTGACCCACTGTTGCAGAATGA)?source=Homo sapiens (human)?to=0&format=json
0.096 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCAGCCCCTGAGATATTTTGCTCA)?source=Homo sapiens (human)?to=0&format=json
0.106 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TAGAGCAGGGCTGGTCATACCCTCT)?source=Homo sapiens (human)?to=0&format=json
0.113 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GGAGGGGCAGTGTTAGAGCAGGGCT)?source=Homo sapiens (human)?to=0&format=json
0.121 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCCCCCTCTGCATGTGGGTAGAGGA)?source=Homo sapiens (human)?to=0&format=json
0.128 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAGGATGTACTGGGACTTGGCATTT)?source=Homo sapiens (human)?to=0&format=json
0.135 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAACCAGGATCTGCCTATTACTGCT)?source=Homo sapiens (human)?to=0&format=json
0.142 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGCTTGGGCCAGTGACAATCTGCAA)?source=Homo sapiens (human)?to=0&format=json
0.149 | 0.007 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGCCCCTGAAGGTCCTGGGGAAGCA)?source=Homo sapiens (human)?to=0&format=json
0.163 | 0.014 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAGAGGTAGGACCAGTGCTTTTTTG)?source=Homo sapiens (human)?to=0&format=json
0.584 | 0.422 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTGGCATTTAGGATTCCATCTGGCC)%26(nt:TGCCTGACCCACTGTTGCAGAATGA)%26(nt:TGCAGCCCCTGAGATATTTTGCTCA)%26(nt:TAGAGCAGGGCTGGTCATACCCTCT)%26(nt:GGAGGGGCAGTGTTAGAGCAGGGCT)%26(nt:GCCCCCTCTGCATGTGGGTAGAGGA)%26(nt:GAGGATGTACTGGGACTTGGCATTT)%26(nt:GAACCAGGATCTGCCTATTACTGCT)%26(nt:AGCTTGGGCCAGTGACAATCTGCAA)%26(nt:AGCCCCTGAAGGTCCTGGGGAAGCA)%26(nt:AAGAGGTAGGACCAGTGCTTTTTTG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.590 | 0.006 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]