GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:31:59, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens protocadherin gamma subfamily C, 4 (PCDHGC4), transcript variant 4, mRNA. (2333 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 1755 1863 1878 1980 2013 2050 2137 2186 2206 2245 2281
Synonym: PCDH-GAMMA-C4
NM_001386884.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily C, 3 (PCDHGC3), transcript variant 3, mRNA. (2358 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 1780 1888 1903 2005 2038 2075 2162 2211 2231 2270 2306
Synonym: PC43; PCDH-GAMMA-C3; PCDH2
NM_032403.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant 3, mRNA. (4232 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 3654 3762 3777 3879 3912 3949 4036 4085 4105 4144 4180
Synonym: PCDH-GAMMA-A11
NM_032092.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily B, 6 (PCDHGB6), transcript variant 1, mRNA. (4599 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4017 4125 4140 4242 4275 4312 4399 4448 4468 4507 4543
Synonym: PCDH-GAMMA-B6
NM_018926.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily B, 2 (PCDHGB2), transcript variant 1, mRNA. (4740 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4162 4270 4285 4387 4420 4457 4544 4593 4613 4652 4688
Synonym: PCDH-GAMMA-B2
NM_018923.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily B, 3 (PCDHGB3), transcript variant 1, mRNA. (4745 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4167 4275 4290 4392 4425 4462 4549 4598 4618 4657 4693
Synonym: PCDH-GAMMA-B3
NM_018924.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily B, 1 (PCDHGB1), transcript variant 1, mRNA. (4748 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4170 4278 4293 4395 4428 4465 4552 4601 4621 4660 4696
Synonym: PCDH-GAMMA-B1
NM_018922.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily B, 5 (PCDHGB5), transcript variant 1, mRNA. (4755 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4177 4285 4300 4402 4435 4472 4559 4608 4628 4667 4703
Synonym: PCDH-GAMMA-B5
NM_018925.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily C, 3 (PCDHGC3), transcript variant 1, mRNA. (4758 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4180 4288 4303 4405 4438 4475 4562 4611 4631 4670 4706
Synonym: PC43; PCDH-GAMMA-C3; PCDH2
NM_002588.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 7 (PCDHGA7), transcript variant 1, mRNA. (4759 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4181 4289 4304 4406 4439 4476 4563 4612 4632 4671 4707
Synonym: PCDH-GAMMA-A7
NM_018920.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily B, 4 (PCDHGB4), transcript variant 1, mRNA. (4761 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4183 4291 4306 4408 4441 4478 4565 4614 4634 4673 4709
Synonym: CDH20; FIB2; PCDH-GAMMA-B4
NM_003736.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily C, 4 (PCDHGC4), transcript variant 1, mRNA. (4763 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4185 4293 4308 4410 4443 4480 4567 4616 4636 4675 4711
Synonym: PCDH-GAMMA-C4
NM_018928.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 5 (PCDHGA5), transcript variant 1, mRNA. (4767 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4189 4297 4312 4414 4447 4484 4571 4620 4640 4679 4715
Synonym: CDH-GAMMA-A5; ME3; PCDH-GAMMA-A5
NM_018918.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 1 (PCDHGA1), transcript variant 1, mRNA. (4769 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4191 4299 4314 4416 4449 4486 4573 4622 4642 4681 4717
Synonym: PCDH-GAMMA-A1
NM_018912.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily B, 7 (PCDHGB7), transcript variant 1, mRNA. (4775 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4197 4305 4320 4422 4455 4492 4579 4628 4648 4687 4723
Synonym: ME6; PCDH-GAMMA-B7
NM_018927.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 1, mRNA. (4776 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4198 4306 4321 4423 4456 4493 4580 4629 4649 4688 4724
Synonym: PCDH-GAMMA-A9
NM_018921.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 4 (PCDHGA4), transcript variant 1, mRNA. (4778 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4200 4308 4323 4425 4458 4495 4582 4631 4651 4690 4726
Synonym: PCDH-GAMMA-A4
NM_018917.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 1, mRNA. (4782 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4204 4312 4327 4429 4462 4499 4586 4635 4655 4694 4730
Synonym: PCDH-GAMMA-A8
NM_032088.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant 1, mRNA. (4787 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4209 4317 4332 4434 4467 4504 4591 4640 4660 4699 4735
Synonym: PCDH-GAMMA-A11
NM_018914.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 6 (PCDHGA6), transcript variant 1, mRNA. (4794 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4216 4324 4339 4441 4474 4511 4598 4647 4667 4706 4742
Synonym: PCDH-GAMMA-A6
NM_018919.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily C, 5 (PCDHGC5), transcript variant 1, mRNA. (4797 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4219 4327 4342 4444 4477 4514 4601 4650 4670 4709 4745
Synonym: PCDH-GAMMA-C5
NM_018929.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 10 (PCDHGA10), transcript variant 1, mRNA. (4802 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4224 4332 4347 4449 4482 4519 4606 4655 4675 4714 4750
Synonym: PCDH-GAMMA-A10
NM_018913.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 3 (PCDHGA3), transcript variant 1, mRNA. (4806 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4228 4336 4351 4453 4486 4523 4610 4659 4679 4718 4754
Synonym: PCDH-GAMMA-A3
NM_018916.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 2 (PCDHGA2), transcript variant 1, mRNA. (4813 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4235 4343 4358 4460 4493 4530 4617 4666 4686 4725 4761
Synonym: PCDH-GAMMA-A2
NM_018915.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens protocadherin gamma subfamily A, 12 (PCDHGA12), transcript variant 1, mRNA. (4854 bp)
caaatgaacagaaagtctcagcccaggatggggcttcttcaacagggcccctgccctcctgaagcctcagtccttcaccttgccaggtgccgtttctcttccgtgaaggccactgcccaggtccccagtgcgccccctagtggccatagcctggttaaagttccccagtgcctccttgtgcatagaccttcttctcccacccccttctgcccctgggtccccggccatccagcggggctgccagagaaccccagacctgcccttacagtagtgtagcgccccctccctctttcggctggtgtagaatagccagtagtgtagtgcggtgtgcttttacgtgatggcgggtgggcagcgggcggcgggctccgcgcagccgtctgtccttgatctgcccgcggcggcccgtgttgtgttttgtgctgtgtccacgcgctaaggcgaccccctcccccgtactgacttctcctataagcgcttctcttcgcatagtcacgtagctcccaccccaccctcttcctgtgtctcacgcaagttttatactctaatatttatatggctttttttcttcgacaaaaaaataataaaacgtttcttctg...
position 4276 4384 4399 4501 4534 4571 4658 4707 4727 4766 4802
Synonym: CDH21; FIB3; PCDH-GAMMA-A12
NM_003735.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/211066_x_at
lang : en | div : | spe : hs | query_string : 211066_x_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.086 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATATGGCTTTTTTTCTTCGACAA)?source=Homo sapiens (human)?to=0&format=json
0.099 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCCTCTTTCGGCTGGTGTAGAATA)?source=Homo sapiens (human)?to=0&format=json
0.109 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACTGACTTCTCCTATAAGCGCTTC)?source=Homo sapiens (human)?to=0&format=json
0.122 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGTTGTGTTTTGTGCTGTGTCCAC)?source=Homo sapiens (human)?to=0&format=json
0.134 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGCGGTGTGCTTTTACGTGATGGC)?source=Homo sapiens (human)?to=0&format=json
0.145 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGATGGGGCTTCTTCAACAGGGCCC)?source=Homo sapiens (human)?to=0&format=json
0.158 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTTCTCTTCGCATAGTCACGTAGC)?source=Homo sapiens (human)?to=0&format=json
0.183 | 0.025 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTGGTTAAAGTTCCCCAGTGCCT)?source=Homo sapiens (human)?to=0&format=json
0.196 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCCTGTGTCTCACGCAAGTTTTA)?source=Homo sapiens (human)?to=0&format=json
0.206 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCCTAGTGGCCATAGCCTGGTTAA)?source=Homo sapiens (human)?to=0&format=json
0.216 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAGACCTGCCCTTACAGTAGTGTA)?source=Homo sapiens (human)?to=0&format=json
0.752 | 0.536 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATATGGCTTTTTTTCTTCGACAA)%26(nt:TCCCTCTTTCGGCTGGTGTAGAATA)%26(nt:TACTGACTTCTCCTATAAGCGCTTC)%26(nt:GTGTTGTGTTTTGTGCTGTGTCCAC)%26(nt:GTGCGGTGTGCTTTTACGTGATGGC)%26(nt:GGATGGGGCTTCTTCAACAGGGCCC)%26(nt:GCTTCTCTTCGCATAGTCACGTAGC)%26(nt:GCCTGGTTAAAGTTCCCCAGTGCCT)%26(nt:CTTCCTGTGTCTCACGCAAGTTTTA)%26(nt:CCCCTAGTGGCCATAGCCTGGTTAA)%26(nt:CCAGACCTGCCCTTACAGTAGTGTA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.767 | 0.016 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]