GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2020-12-05 23:43:10, GGRNA : RefSeq release 202 (Sep, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens milk fat globule EGF and factor V/VIII domain containing (MFGE8), transcript variant 2, mRNA. (1780 bp)
caccctccacctctcacgggccctgccccagcccctaagccccgtcccctaacccccagtcctcactgtcctgttttcttaggcactgagggatctgagtaggtctgggatggacaggaaagggcaaagtagggcgtgtggtttccctgcccctgtccggaccgccgatcccaggtgcgtgtgtctctgtctctcctagcccctctctcacacatcacattcccatggtggcctcaagaaaggcccggaagcgccaggctggagataacagcctcttgcccgtcggccctgcgtcggccctggggtaccatgtggccacaactgctgtggccccctgtccccaagacacttccccttgtctccctggttgcctctcttgccccttgtcctgaagcccagcgacacagaagggggtggggcgggtctatggggagaaagggagcgaggtcagaggagggcatgggttggcagggtgggcgtttggggccctctatgctggcttttcaccccagaggacacaggcagcttccaaaatatatttatcttcttcacgggaa
position 1285 1290 1309 1341 1348 1441 1451 1481 1614 1637 1738
Synonym: BA46; EDIL1; HMFG; hP47; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10
NM_001114614.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens milk fat globule EGF and factor V/VIII domain containing (MFGE8), transcript variant 4, mRNA. (1804 bp)
caccctccacctctcacgggccctgccccagcccctaagccccgtcccctaacccccagtcctcactgtcctgttttcttaggcactgagggatctgagtaggtctgggatggacaggaaagggcaaagtagggcgtgtggtttccctgcccctgtccggaccgccgatcccaggtgcgtgtgtctctgtctctcctagcccctctctcacacatcacattcccatggtggcctcaagaaaggcccggaagcgccaggctggagataacagcctcttgcccgtcggccctgcgtcggccctggggtaccatgtggccacaactgctgtggccccctgtccccaagacacttccccttgtctccctggttgcctctcttgccccttgtcctgaagcccagcgacacagaagggggtggggcgggtctatggggagaaagggagcgaggtcagaggagggcatgggttggcagggtgggcgtttggggccctctatgctggcttttcaccccagaggacacaggcagcttccaaaatatatttatcttcttcacgggaa
position 1309 1314 1333 1365 1372 1465 1475 1505 1638 1661 1762
Synonym: BA46; EDIL1; HMFG; hP47; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10
NM_001310319.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens milk fat globule EGF and factor V/VIII domain containing (MFGE8), transcript variant 1, mRNA. (1936 bp)
caccctccacctctcacgggccctgccccagcccctaagccccgtcccctaacccccagtcctcactgtcctgttttcttaggcactgagggatctgagtaggtctgggatggacaggaaagggcaaagtagggcgtgtggtttccctgcccctgtccggaccgccgatcccaggtgcgtgtgtctctgtctctcctagcccctctctcacacatcacattcccatggtggcctcaagaaaggcccggaagcgccaggctggagataacagcctcttgcccgtcggccctgcgtcggccctggggtaccatgtggccacaactgctgtggccccctgtccccaagacacttccccttgtctccctggttgcctctcttgccccttgtcctgaagcccagcgacacagaagggggtggggcgggtctatggggagaaagggagcgaggtcagaggagggcatgggttggcagggtgggcgtttggggccctctatgctggcttttcaccccagaggacacaggcagcttccaaaatatatttatcttcttcacgggaa
position 1441 1446 1465 1497 1504 1597 1607 1637 1770 1793 1894
Synonym: BA46; EDIL1; HMFG; hP47; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10
NM_005928.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens milk fat globule EGF and factor V/VIII domain containing (MFGE8), transcript variant 3, mRNA. (1989 bp)
caccctccacctctcacgggccctgccccagcccctaagccccgtcccctaacccccagtcctcactgtcctgttttcttaggcactgagggatctgagtaggtctgggatggacaggaaagggcaaagtagggcgtgtggtttccctgcccctgtccggaccgccgatcccaggtgcgtgtgtctctgtctctcctagcccctctctcacacatcacattcccatggtggcctcaagaaaggcccggaagcgccaggctggagataacagcctcttgcccgtcggccctgcgtcggccctggggtaccatgtggccacaactgctgtggccccctgtccccaagacacttccccttgtctccctggttgcctctcttgccccttgtcctgaagcccagcgacacagaagggggtggggcgggtctatggggagaaagggagcgaggtcagaggagggcatgggttggcagggtgggcgtttggggccctctatgctggcttttcaccccagaggacacaggcagcttccaaaatatatttatcttcttcacgggaa
position 1494 1499 1518 1550 1557 1650 1660 1690 1823 1846 1947
Synonym: BA46; EDIL1; HMFG; hP47; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10
NM_001310320.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens milk fat globule EGF and factor V/VIII domain containing (MFGE8), transcript variant X1, mRNA. (2078 bp)
caccctccacctctcacgggccctgccccagcccctaagccccgtcccctaacccccagtcctcactgtcctgttttcttaggcactgagggatctgagtaggtctgggatggacaggaaagggcaaagtagggcgtgtggtttccctgcccctgtccggaccgccgatcccaggtgcgtgtgtctctgtctctcctagcccctctctcacacatcacattcccatggtggcctcaagaaaggcccggaagcgccaggctggagataacagcctcttgcccgtcggccctgcgtcggccctggggtaccatgtggccacaactgctgtggccccctgtccccaagacacttccccttgtctccctggttgcctctcttgccccttgtcctgaagcccagcgacacagaagggggtggggcgggtctatggggagaaagggagcgaggtcagaggagggcatgggttggcagggtgggcgtttggggccctctatgctggcttttcaccccagaggacacaggcagcttccaaaatatatttatcttcttcacgggaa
position 1583 1588 1607 1639 1646 1739 1749 1779 1912 1935 2036
Synonym: BA46; EDIL1; HMFG; hP47; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10
XM_024449930.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens milk fat globule EGF and factor V/VIII domain containing (MFGE8), transcript variant 5, mRNA. (2544 bp)
caccctccacctctcacgggccctgccccagcccctaagccccgtcccctaacccccagtcctcactgtcctgttttcttaggcactgagggatctgagtaggtctgggatggacaggaaagggcaaagtagggcgtgtggtttccctgcccctgtccggaccgccgatcccaggtgcgtgtgtctctgtctctcctagcccctctctcacacatcacattcccatggtggcctcaagaaaggcccggaagcgccaggctggagataacagcctcttgcccgtcggccctgcgtcggccctggggtaccatgtggccacaactgctgtggccccctgtccccaagacacttccccttgtctccctggttgcctctcttgccccttgtcctgaagcccagcgacacagaagggggtggggcgggtctatggggagaaagggagcgaggtcagaggagggcatgggttggcagggtgggcgtttggggccctctatgctggcttttcaccccagaggacacaggcagcttccaaaatatatttatcttcttcacgggaa
position 2049 2054 2073 2105 2112 2205 2215 2245 2378 2401 2502
Synonym: BA46; EDIL1; HMFG; hP47; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10
NM_001310321.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/210605_s_at
lang : en | div : | spe : hs | query_string : 210605_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGTCCTGTTTTCTTAGGCACTGAGG)?source=Homo sapiens (human)?to=0&format=json
0.103 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTGGGGCGGGTCTATGGGGAGAAAG)?source=Homo sapiens (human)?to=0&format=json
0.115 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTGGCCTCAAGAAAGGCCCGGAAGC)?source=Homo sapiens (human)?to=0&format=json
0.128 | 0.013 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCTGGAGATAACAGCCTCTTGCCCG)?source=Homo sapiens (human)?to=0&format=json
0.138 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GACACAGGCAGCTTCCAAAATATAT)?source=Homo sapiens (human)?to=0&format=json
0.148 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAAGCCCAGCGACACAGAAGGGGGT)?source=Homo sapiens (human)?to=0&format=json
0.164 | 0.016 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAAAGGGCAAAGTAGGGCGTGTGGT)?source=Homo sapiens (human)?to=0&format=json
0.174 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTGAGGGATCTGAGTAGGTCTGGGA)?source=Homo sapiens (human)?to=0&format=json
0.183 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTCACTGTCCTGTTTTCTTAGGCAC)?source=Homo sapiens (human)?to=0&format=json
0.197 | 0.014 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CATTCCCATGGTGGCCTCAAGAAAG)?source=Homo sapiens (human)?to=0&format=json
0.210 | 0.013 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CAAAGTAGGGCGTGTGGTTTCCCTG)?source=Homo sapiens (human)?to=0&format=json
0.349 | 0.140 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGTCCTGTTTTCTTAGGCACTGAGG)%26(nt:GTGGGGCGGGTCTATGGGGAGAAAG)%26(nt:GTGGCCTCAAGAAAGGCCCGGAAGC)%26(nt:GCTGGAGATAACAGCCTCTTGCCCG)%26(nt:GACACAGGCAGCTTCCAAAATATAT)%26(nt:GAAGCCCAGCGACACAGAAGGGGGT)%26(nt:GAAAGGGCAAAGTAGGGCGTGTGGT)%26(nt:CTGAGGGATCTGAGTAGGTCTGGGA)%26(nt:CTCACTGTCCTGTTTTCTTAGGCAC)%26(nt:CATTCCCATGGTGGCCTCAAGAAAG)%26(nt:CAAAGTAGGGCGTGTGGTTTCCCTG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.353 | 0.004 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]