GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-12-12 08:22:28, GGRNA : RefSeq release 91 (Nov, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens potassium voltage-gated channel subfamily J member 1 (KCNJ1), transcript variant 1, mRNA. (2409 bp)
tttggggagatgaaccaaccaatcaatgacaagaaaacgcttacacaaagaacaatttgaggctctaagcttctcatgtggtacgtttagacagaggctaaatctgcacactagaatcttgatgataccttcctgcaagacagaatgctttagttaaaagtggtgatgatatttctttcaatctgtattggatggcttaaagggctataaatctgtttataaagagcatttcctgctcttcgaagacagcaatgaggagttggaaggtgcaaagtcagtagagaagggaatgtatcattaatgcacctgagaagaaacagtttcatgtgttcctccacctagagtttgtactggaatgctatttctaaagaagaagtgggaaagagagaggaatgggatggagccccacagtcagaatgttactatgtctttctttccctgacagcccatcttcctaaaagggaccagcttatggaaggctcgaccttgaggggaaagttttactgtgaaagtcttcttcagatccccacctgcatcattccgaatgtgtcctggaaaaaaactggtactcaaagctgcttaggaatcaaaatgttttca...
position 1813 1828 1856 1876 1989 2075 2092 2162 2207 2224 2289
Synonym: KIR1.1; ROMK; ROMK1
NM_000220.4 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens potassium voltage-gated channel subfamily J member 1 (KCNJ1), transcript variant 2, mRNA. (2457 bp)
tttggggagatgaaccaaccaatcaatgacaagaaaacgcttacacaaagaacaatttgaggctctaagcttctcatgtggtacgtttagacagaggctaaatctgcacactagaatcttgatgataccttcctgcaagacagaatgctttagttaaaagtggtgatgatatttctttcaatctgtattggatggcttaaagggctataaatctgtttataaagagcatttcctgctcttcgaagacagcaatgaggagttggaaggtgcaaagtcagtagagaagggaatgtatcattaatgcacctgagaagaaacagtttcatgtgttcctccacctagagtttgtactggaatgctatttctaaagaagaagtgggaaagagagaggaatgggatggagccccacagtcagaatgttactatgtctttctttccctgacagcccatcttcctaaaagggaccagcttatggaaggctcgaccttgaggggaaagttttactgtgaaagtcttcttcagatccccacctgcatcattccgaatgtgtcctggaaaaaaactggtactcaaagctgcttaggaatcaaaatgttttca...
position 1861 1876 1904 1924 2037 2123 2140 2210 2255 2272 2337
Synonym: KIR1.1; ROMK; ROMK1
NM_153764.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens potassium voltage-gated channel subfamily J member 1 (KCNJ1), transcript variant 3, mRNA. (2590 bp)
tttggggagatgaaccaaccaatcaatgacaagaaaacgcttacacaaagaacaatttgaggctctaagcttctcatgtggtacgtttagacagaggctaaatctgcacactagaatcttgatgataccttcctgcaagacagaatgctttagttaaaagtggtgatgatatttctttcaatctgtattggatggcttaaagggctataaatctgtttataaagagcatttcctgctcttcgaagacagcaatgaggagttggaaggtgcaaagtcagtagagaagggaatgtatcattaatgcacctgagaagaaacagtttcatgtgttcctccacctagagtttgtactggaatgctatttctaaagaagaagtgggaaagagagaggaatgggatggagccccacagtcagaatgttactatgtctttctttccctgacagcccatcttcctaaaagggaccagcttatggaaggctcgaccttgaggggaaagttttactgtgaaagtcttcttcagatccccacctgcatcattccgaatgtgtcctggaaaaaaactggtactcaaagctgcttaggaatcaaaatgttttca...
position 1994 2009 2037 2057 2170 2256 2273 2343 2388 2405 2470
Synonym: KIR1.1; ROMK; ROMK1
NM_153765.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens potassium voltage-gated channel subfamily J member 1 (KCNJ1), transcript variant 4, mRNA. (2627 bp)
tttggggagatgaaccaaccaatcaatgacaagaaaacgcttacacaaagaacaatttgaggctctaagcttctcatgtggtacgtttagacagaggctaaatctgcacactagaatcttgatgataccttcctgcaagacagaatgctttagttaaaagtggtgatgatatttctttcaatctgtattggatggcttaaagggctataaatctgtttataaagagcatttcctgctcttcgaagacagcaatgaggagttggaaggtgcaaagtcagtagagaagggaatgtatcattaatgcacctgagaagaaacagtttcatgtgttcctccacctagagtttgtactggaatgctatttctaaagaagaagtgggaaagagagaggaatgggatggagccccacagtcagaatgttactatgtctttctttccctgacagcccatcttcctaaaagggaccagcttatggaaggctcgaccttgaggggaaagttttactgtgaaagtcttcttcagatccccacctgcatcattccgaatgtgtcctggaaaaaaactggtactcaaagctgcttaggaatcaaaatgttttca...
position 2031 2046 2074 2094 2207 2293 2310 2380 2425 2442 2507
Synonym: KIR1.1; ROMK; ROMK1
NM_153766.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens potassium voltage-gated channel subfamily J member 1 (KCNJ1), transcript variant 5, mRNA. (2760 bp)
tttggggagatgaaccaaccaatcaatgacaagaaaacgcttacacaaagaacaatttgaggctctaagcttctcatgtggtacgtttagacagaggctaaatctgcacactagaatcttgatgataccttcctgcaagacagaatgctttagttaaaagtggtgatgatatttctttcaatctgtattggatggcttaaagggctataaatctgtttataaagagcatttcctgctcttcgaagacagcaatgaggagttggaaggtgcaaagtcagtagagaagggaatgtatcattaatgcacctgagaagaaacagtttcatgtgttcctccacctagagtttgtactggaatgctatttctaaagaagaagtgggaaagagagaggaatgggatggagccccacagtcagaatgttactatgtctttctttccctgacagcccatcttcctaaaagggaccagcttatggaaggctcgaccttgaggggaaagttttactgtgaaagtcttcttcagatccccacctgcatcattccgaatgtgtcctggaaaaaaactggtactcaaagctgcttaggaatcaaaatgttttca...
position 2164 2179 2207 2227 2340 2426 2443 2513 2558 2575 2640
Synonym: KIR1.1; ROMK; ROMK1
NM_153767.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/210402_at
lang : en | div : | spe : hs | query_string : 210402_at | format : html | download :

0.000 | 0.000 | search_start;
0.194 | 0.194 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCTCCACCTAGAGTTTGTACTGG)?source=Homo sapiens (human)?to=0&format=json
0.205 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAGCTTCTCATGTGGTACGTTTAG)?source=Homo sapiens (human)?to=0&format=json
0.221 | 0.016 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGCCCCACAGTCAGAATGTTACT)?source=Homo sapiens (human)?to=0&format=json
0.233 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACCAGCTTATGGAAGGCTCGACC)?source=Homo sapiens (human)?to=0&format=json
0.243 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCCATCTTCCTAAAAGGGACCAGC)?source=Homo sapiens (human)?to=0&format=json
0.253 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGCTAAATCTGCACACTAGAATC)?source=Homo sapiens (human)?to=0&format=json
0.265 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATCTTGATGATACCTTCCTGCAA)?source=Homo sapiens (human)?to=0&format=json
0.276 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCACCTGCATCATTCCGAATGTGTC)?source=Homo sapiens (human)?to=0&format=json
0.287 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATTTCCTGCTCTTCGAAGACAGCA)?source=Homo sapiens (human)?to=0&format=json
0.296 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAAACAGTTTCATGTGTTCCTCCA)?source=Homo sapiens (human)?to=0&format=json
0.310 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACAATTTGAGGCTCTAAGCTTCTC)?source=Homo sapiens (human)?to=0&format=json
0.416 | 0.106 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCTCCACCTAGAGTTTGTACTGG)%26(nt:TAAGCTTCTCATGTGGTACGTTTAG)%26(nt:GGAGCCCCACAGTCAGAATGTTACT)%26(nt:GGACCAGCTTATGGAAGGCTCGACC)%26(nt:GCCCATCTTCCTAAAAGGGACCAGC)%26(nt:GAGGCTAAATCTGCACACTAGAATC)%26(nt:GAATCTTGATGATACCTTCCTGCAA)%26(nt:CCACCTGCATCATTCCGAATGTGTC)%26(nt:CATTTCCTGCTCTTCGAAGACAGCA)%26(nt:AGAAACAGTTTCATGTGTTCCTCCA)%26(nt:AACAATTTGAGGCTCTAAGCTTCTC)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.419 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]