GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2024-04-24 10:00:46, GGRNA : RefSeq release 222 (Jan, 2024)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens gamma-glutamyltransferase 1 (GGT1), transcript variant 3, mRNA. (2354 bp)
ttggggaccccaagtttgtggatgtgactgaggtggtccgcaacatgacctccgagttcttcgctgcccagctccgggcccagatctctgacgacaccactcacccgatctcctactacaagcccgagttctacacgccggatgacgggggcactgctcacctgtctgtcgtcgcagaggacggcagtgctgtgtccgccaccagcaccatcaacctctactttggctccaaggtccgctccccggtcagcgggatcctgttcaataatgaaatggacgacttcagctctcccagcatcaccaacgagtttggggtacccccctcacctgccaatttcatccagccagggaagcagccgctctcgtccatgtgcccgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacacagatcaccacggccactgcactggccatcatctacaacctctggttcggctatgacgtgaagcgggccgtggaggagccccggctgcacaaccagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagaccc...
position 1764
Synonym: CD224; D22S672; D22S732; GGT; GGT 1; GGTD; GTG
NM_013430.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens gamma-glutamyltransferase 1 (GGT1), transcript variant 2, mRNA. (2558 bp)
ttggggaccccaagtttgtggatgtgactgaggtggtccgcaacatgacctccgagttcttcgctgcccagctccgggcccagatctctgacgacaccactcacccgatctcctactacaagcccgagttctacacgccggatgacgggggcactgctcacctgtctgtcgtcgcagaggacggcagtgctgtgtccgccaccagcaccatcaacctctactttggctccaaggtccgctccccggtcagcgggatcctgttcaataatgaaatggacgacttcagctctcccagcatcaccaacgagtttggggtacccccctcacctgccaatttcatccagccagggaagcagccgctctcgtccatgtgcccgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacacagatcaccacggccactgcactggccatcatctacaacctctggttcggctatgacgtgaagcgggccgtggaggagccccggctgcacaaccagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagaccc...
position 1968
Synonym: CD224; D22S672; D22S732; GGT; GGT 1; GGTD; GTG
NM_013421.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens gamma-glutamyltransferase 1 (GGT1), transcript variant 6, mRNA. (2630 bp)
ttggggaccccaagtttgtggatgtgactgaggtggtccgcaacatgacctccgagttcttcgctgcccagctccgggcccagatctctgacgacaccactcacccgatctcctactacaagcccgagttctacacgccggatgacgggggcactgctcacctgtctgtcgtcgcagaggacggcagtgctgtgtccgccaccagcaccatcaacctctactttggctccaaggtccgctccccggtcagcgggatcctgttcaataatgaaatggacgacttcagctctcccagcatcaccaacgagtttggggtacccccctcacctgccaatttcatccagccagggaagcagccgctctcgtccatgtgcccgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacacagatcaccacggccactgcactggccatcatctacaacctctggttcggctatgacgtgaagcgggccgtggaggagccccggctgcacaaccagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagaccc...
position 2040
Synonym: CD224; D22S672; D22S732; GGT; GGT 1; GGTD; GTG
NM_001288833.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/seq%3aCTCCCAGCATCACCAACGAGTTTGG
lang : en | div : | spe : hs | query_string : seq:CTCCCAGCATCACCAACGAGTTTGG | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTCCCAGCATCACCAACGAGTTTGG)?source=Homo sapiens (human)?to=0&format=json
0.156 | 0.069 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTCCCAGCATCACCAACGAGTTTGG)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.156 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]