GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:58:05, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X20, misc_RNA. (7388 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 6830 6850 6907 6954 6976 7013 7063 7078 7199 7221 7288
Synonym: Dyna III
XR_001737111.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X19, misc_RNA. (7520 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 6962 6982 7039 7086 7108 7145 7195 7210 7331 7353 7420
Synonym: Dyna III
XR_001737110.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X5, mRNA. (7522 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 6964 6984 7041 7088 7110 7147 7197 7212 7333 7355 7422
Synonym: Dyna III
XM_017000980.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X12, mRNA. (7532 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 6974 6994 7051 7098 7120 7157 7207 7222 7343 7365 7432
Synonym: Dyna III
XM_017000987.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dynamin 3 (DNM3), transcript variant 2, mRNA. (7615 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7057 7077 7134 7181 7203 7240 7290 7305 7426 7448 7515
Synonym: Dyna III
NM_001136127.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dynamin 3 (DNM3), transcript variant 1, mRNA. (7627 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7069 7089 7146 7193 7215 7252 7302 7317 7438 7460 7527
Synonym: Dyna III
NM_015569.5 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dynamin 3 (DNM3), transcript variant 4, mRNA. (7645 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7087 7107 7164 7211 7233 7270 7320 7335 7456 7478 7545
Synonym: Dyna III
NM_001350204.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X6, mRNA. (7660 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7102 7122 7179 7226 7248 7285 7335 7350 7471 7493 7560
Synonym: Dyna III
XM_005245079.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens dynamin 3 (DNM3), transcript variant 7, non-coding RNA. (7661 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7103 7123 7180 7227 7249 7286 7336 7351 7472 7494 7561
Synonym: Dyna III
NR_146559.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X16, misc_RNA. (7676 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7118 7138 7195 7242 7264 7301 7351 7366 7487 7509 7576
Synonym: Dyna III
XR_001737108.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X3, mRNA. (7774 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7216 7236 7293 7340 7362 7399 7449 7464 7585 7607 7674
Synonym: Dyna III
XM_017000978.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X2, mRNA. (7792 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7234 7254 7311 7358 7380 7417 7467 7482 7603 7625 7692
Synonym: Dyna III
XM_017000977.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X1, mRNA. (7804 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 7246 7266 7323 7370 7392 7429 7479 7494 7615 7637 7704
Synonym: Dyna III
XM_017000976.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X7, mRNA. (21971 bp)
agagaggaaactcaaagaggagtgtttgtcttaagacctgttcatactggtatattggtgagacttctcacttctggttggaggtttcacatatggctcaactcaagtcattaatctctttttaatttttactcttgaattccttaaacttcgctcattatgaaatgttttaaaattatgacaaaaattactctgtctaaccacttgccttgtctgctaccagtttgttaaaaattattccccccaaccagtaattccaccagtactacttgatttgtgttatatttcctatgtacatgtacagcctttgttttgcttgcttgtctatttttactttcccttttttgggtcaaatttttcttttgctttgtttgaagaaggaatatacagaagtaaaatcttgtcttctctgctgattctttaattaatatgagccggatactttccactgtcttcttggcactttcaggatttcttaatgctgatatatggactcttagaatggaatttttgaagaaaaatctcaaagcctgtatcgttcttgaaggtcacatgtacctattgtgaaaatgtgaagctgtatttctgaagctgaaataa...
position 21413 21433 21490 21537 21559 21596 21646 21661 21782 21804 21871
Synonym: Dyna III
XM_017000982.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/209839_at
lang : en | div : | spe : hs | query_string : 209839_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTTTTGCTTGCTTGTCTATTTTT)?source=Homo sapiens (human)?to=0&format=json
0.100 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCTTGTCTGCTACCAGTTTGTTA)?source=Homo sapiens (human)?to=0&format=json
0.112 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATGAGCCGGATACTTTCCACTGTC)?source=Homo sapiens (human)?to=0&format=json
0.123 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTTCTTGGCACTTTCAGGATTTC)?source=Homo sapiens (human)?to=0&format=json
0.133 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACATGTACAGCCTTTGTTTTGCT)?source=Homo sapiens (human)?to=0&format=json
0.143 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAGGTTTCACATATGGCTCAACTC)?source=Homo sapiens (human)?to=0&format=json
0.153 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACTTCTCACTTCTGGTTGGAGG)?source=Homo sapiens (human)?to=0&format=json
0.172 | 0.019 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATTCCTTAAACTTCGCTCATTAT)?source=Homo sapiens (human)?to=0&format=json
0.181 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAACCAGTAATTCCACCAGTACT)?source=Homo sapiens (human)?to=0&format=json
0.191 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAATTACTCTGTCTAACCACTTGC)?source=Homo sapiens (human)?to=0&format=json
0.202 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAATCTCAAAGCCTGTATCGTTCT)?source=Homo sapiens (human)?to=0&format=json
0.661 | 0.460 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTTTTGCTTGCTTGTCTATTTTT)%26(nt:TGCCTTGTCTGCTACCAGTTTGTTA)%26(nt:TATGAGCCGGATACTTTCCACTGTC)%26(nt:GTCTTCTTGGCACTTTCAGGATTTC)%26(nt:GTACATGTACAGCCTTTGTTTTGCT)%26(nt:GGAGGTTTCACATATGGCTCAACTC)%26(nt:GAGACTTCTCACTTCTGGTTGGAGG)%26(nt:GAATTCCTTAAACTTCGCTCATTAT)%26(nt:CCCAACCAGTAATTCCACCAGTACT)%26(nt:AAAATTACTCTGTCTAACCACTTGC)%26(nt:AAAATCTCAAAGCCTGTATCGTTCT)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.670 | 0.009 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]