GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:35:37, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 8, non-coding RNA. (1694 bp)
gaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttgatttgtgcagaatggattaatgtttctgttagatgacctagtatggaattgttacttagtgctgccacctgctggatgttaaaaggtatttcagtacaactggaatttaaatatttccattgtttttccaaagcagttaacccaactcctaacaacattttcgggggatctgaccttttttttccagttgaaatgtattaacacaccttccacaatcattttataagagtcagcataacatagtggataagaaatgtgagatgtttaacctctcagtaactcggttctctcattataaaataggaataaaatcagtacctgtttcatatgaaggtcgtttctgagaattaaatggactaatgtatgcaaaaagcctggcaaacaataaacactcatctgacttta
position 1153 1203 1266 1307 1416 1442 1488 1545 1560 1610 1660
Synonym: CCBL2; KAT3; KATIII
NR_146184.2 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 2, mRNA. (1715 bp)
gaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttgatttgtgcagaatggattaatgtttctgttagatgacctagtatggaattgttacttagtgctgccacctgctggatgttaaaaggtatttcagtacaactggaatttaaatatttccattgtttttccaaagcagttaacccaactcctaacaacattttcgggggatctgaccttttttttccagttgaaatgtattaacacaccttccacaatcattttataagagtcagcataacatagtggataagaaatgtgagatgtttaacctctcagtaactcggttctctcattataaaataggaataaaatcagtacctgtttcatatgaaggtcgtttctgagaattaaatggactaatgtatgcaaaaagcctggcaaacaataaacactcatctgacttta
position 1174 1224 1287 1328 1437 1463 1509 1566 1581 1631 1681
Synonym: CCBL2; KAT3; KATIII
NM_001008662.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 1, mRNA. (1815 bp)
gaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttgatttgtgcagaatggattaatgtttctgttagatgacctagtatggaattgttacttagtgctgccacctgctggatgttaaaaggtatttcagtacaactggaatttaaatatttccattgtttttccaaagcagttaacccaactcctaacaacattttcgggggatctgaccttttttttccagttgaaatgtattaacacaccttccacaatcattttataagagtcagcataacatagtggataagaaatgtgagatgtttaacctctcagtaactcggttctctcattataaaataggaataaaatcagtacctgtttcatatgaaggtcgtttctgagaattaaatggactaatgtatgcaaaaagcctggcaaacaataaacactcatctgacttta
position 1274 1324 1387 1428 1537 1563 1609 1666 1681 1731 1781
Synonym: CCBL2; KAT3; KATIII
NM_001008661.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 3, mRNA. (1914 bp)
gaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttgatttgtgcagaatggattaatgtttctgttagatgacctagtatggaattgttacttagtgctgccacctgctggatgttaaaaggtatttcagtacaactggaatttaaatatttccattgtttttccaaagcagttaacccaactcctaacaacattttcgggggatctgaccttttttttccagttgaaatgtattaacacaccttccacaatcattttataagagtcagcataacatagtggataagaaatgtgagatgtttaacctctcagtaactcggttctctcattataaaataggaataaaatcagtacctgtttcatatgaaggtcgtttctgagaattaaatggactaatgtatgcaaaaagcctggcaaacaataaacactcatctgactttagccggt
position 1367 1417 1480 1521 1630 1656 1702 1759 1774 1824 1874
Synonym: CCBL2; KAT3; KATIII
NM_001349447.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 5, mRNA. (1997 bp)
gaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttgatttgtgcagaatggattaatgtttctgttagatgacctagtatggaattgttacttagtgctgccacctgctggatgttaaaaggtatttcagtacaactggaatttaaatatttccattgtttttccaaagcagttaacccaactcctaacaacattttcgggggatctgaccttttttttccagttgaaatgtattaacacaccttccacaatcattttataagagtcagcataacatagtggataagaaatgtgagatgtttaacctctcagtaactcggttctctcattataaaataggaataaaatcagtacctgtttcatatgaaggtcgtttctgagaattaaatggactaatgtatgcaaaaagcctggcaaacaataaacactcatctgactttagccggt
position 1450 1500 1563 1604 1713 1739 1785 1842 1857 1907 1957
Synonym: CCBL2; KAT3; KATIII
NM_001349449.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 4, mRNA. (2024 bp)
gaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttgatttgtgcagaatggattaatgtttctgttagatgacctagtatggaattgttacttagtgctgccacctgctggatgttaaaaggtatttcagtacaactggaatttaaatatttccattgtttttccaaagcagttaacccaactcctaacaacattttcgggggatctgaccttttttttccagttgaaatgtattaacacaccttccacaatcattttataagagtcagcataacatagtggataagaaatgtgagatgtttaacctctcagtaactcggttctctcattataaaataggaataaaatcagtacctgtttcatatgaaggtcgtttctgagaattaaatggactaatgtatgcaaaaagcctggcaaacaataaacactcatctgactttagccggt
position 1477 1527 1590 1631 1740 1766 1812 1869 1884 1934 1984
Synonym: CCBL2; KAT3; KATIII
NM_001349448.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 6, mRNA. (2110 bp)
gaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttgatttgtgcagaatggattaatgtttctgttagatgacctagtatggaattgttacttagtgctgccacctgctggatgttaaaaggtatttcagtacaactggaatttaaatatttccattgtttttccaaagcagttaacccaactcctaacaacattttcgggggatctgaccttttttttccagttgaaatgtattaacacaccttccacaatcattttataagagtcagcataacatagtggataagaaatgtgagatgtttaacctctcagtaactcggttctctcattataaaataggaataaaatcagtacctgtttcatatgaaggtcgtttctgagaattaaatggactaatgtatgcaaaaagcctggcaaacaataaacactcatctgactttagccggtaaaaaaaaaaaaa
position 1550 1600 1663 1704 1813 1839 1885 1942 1957 2007 2057
Synonym: CCBL2; KAT3; KATIII
NM_001349450.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/hs/209472_at
lang : en | div : | spe : hs | query_string : 209472_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCAGTAACTCGGTTCTCTCATTA)?source=Homo sapiens (human)?to=0&format=json
0.100 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCAAAGCAGTTAACCCAACTCCTA)?source=Homo sapiens (human)?to=0&format=json
0.111 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAATGTTTCTGTTAGATGACCTAGT)?source=Homo sapiens (human)?to=0&format=json
0.121 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAACACACCTTCCACAATCATTTTA)?source=Homo sapiens (human)?to=0&format=json
0.131 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTGTGCGTTTTTGCTTCATTAAA)?source=Homo sapiens (human)?to=0&format=json
0.141 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTCATATGAAGGTCGTTTCTGAG)?source=Homo sapiens (human)?to=0&format=json
0.152 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGAGATGTTTAACCTCTCAGTAAC)?source=Homo sapiens (human)?to=0&format=json
0.162 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCATGGAGTGTACAGAAGTCTTGA)?source=Homo sapiens (human)?to=0&format=json
0.174 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAACATTTTCGGGGGATCTGACCTT)?source=Homo sapiens (human)?to=0&format=json
0.184 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCCCCGTTTCAGCATTCTGTAACT)?source=Homo sapiens (human)?to=0&format=json
0.194 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGCCTGGCAAACAATAAACACTCA)?source=Homo sapiens (human)?to=0&format=json
0.312 | 0.118 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCAGTAACTCGGTTCTCTCATTA)%26(nt:TCCAAAGCAGTTAACCCAACTCCTA)%26(nt:TAATGTTTCTGTTAGATGACCTAGT)%26(nt:TAACACACCTTCCACAATCATTTTA)%26(nt:GTTTGTGCGTTTTTGCTTCATTAAA)%26(nt:GTTTCATATGAAGGTCGTTTCTGAG)%26(nt:GTGAGATGTTTAACCTCTCAGTAAC)%26(nt:GGCATGGAGTGTACAGAAGTCTTGA)%26(nt:CAACATTTTCGGGGGATCTGACCTT)%26(nt:ATCCCCGTTTCAGCATTCTGTAACT)%26(nt:AAGCCTGGCAAACAATAAACACTCA)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.316 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]